ID: 903627910

View in Genome Browser
Species Human (GRCh38)
Location 1:24744877-24744899
Sequence CTTGGGGAGGTAGCCGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903627900_903627910 21 Left 903627900 1:24744833-24744855 CCAGTAAGTTGTCTTGGAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 903627910 1:24744877-24744899 CTTGGGGAGGTAGCCGCTGCGGG 0: 1
1: 0
2: 0
3: 15
4: 210
903627906_903627910 -7 Left 903627906 1:24744861-24744883 CCGCGTAATAGAGGGACTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 903627910 1:24744877-24744899 CTTGGGGAGGTAGCCGCTGCGGG 0: 1
1: 0
2: 0
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903627910 Original CRISPR CTTGGGGAGGTAGCCGCTGC GGG Intergenic
900242927 1:1625482-1625504 CTTGGGGAGGAAGGGGCTGAGGG - Intronic
900249998 1:1663710-1663732 CTTTGGGAGGCAGCAGCTGGCGG - Exonic
901042768 1:6375422-6375444 CTTTGGGAGGTAGACGCGGGCGG + Intronic
901597789 1:10399036-10399058 TTTCTGGAGGGAGCCGCTGCGGG + Intronic
902831652 1:19017742-19017764 CCTGGGGAGGTTGAAGCTGCAGG + Intergenic
903627910 1:24744877-24744899 CTTGGGGAGGTAGCCGCTGCGGG + Intergenic
903659828 1:24970215-24970237 CCTGGCGAGGCAGACGCTGCGGG - Intergenic
905216773 1:36414145-36414167 CTTGAGGAGGTCGAGGCTGCAGG + Intergenic
905572137 1:39014440-39014462 CTTGGGTGGGCAGCCTCTGCAGG - Intergenic
906137577 1:43510316-43510338 CTTGGGGAGGGAACAGATGCTGG - Intergenic
907524094 1:55043943-55043965 CTTGGTGAGGTATCCCCGGCGGG - Exonic
911521077 1:98931572-98931594 CTTGGGGAGGAAGGCGGGGCTGG + Intronic
913427747 1:118753166-118753188 CTTGGGGAGGTGGCTGCTCTTGG - Intergenic
915203420 1:154251145-154251167 GCTGTGGAGGTAGCCACTGCAGG - Exonic
915303775 1:154966377-154966399 CTTCGGGAAGGAGCCGCTCCAGG - Exonic
919331844 1:196181929-196181951 CTTGGAGAGGGAGATGCTGCTGG - Intergenic
919573856 1:199281997-199282019 CCTGGGGAGGTTGAGGCTGCAGG + Intergenic
919897457 1:202018235-202018257 CCTGGGCAGGTGGCCTCTGCAGG + Intergenic
920747730 1:208644764-208644786 CTGGGGGAGGGAGCTGCTGGGGG - Intergenic
920747736 1:208644780-208644802 CTGGGGGAGGGAGCTGCTGGGGG - Intergenic
920747742 1:208644796-208644818 CTGGGGGAGGGAGCTGCTGGGGG - Intergenic
923001883 1:230012923-230012945 CTTGGTTAGTTAGCAGCTGCGGG + Intergenic
923755516 1:236787573-236787595 CTTTGGGAGGTAGAGGCTGGTGG - Intergenic
1064545615 10:16447342-16447364 CTTTGGGAGGTTGCGGCTGGAGG - Intronic
1065697474 10:28392965-28392987 CTTGGATAGTTAGCAGCTGCAGG + Intergenic
1069874067 10:71550932-71550954 CTAGGGGAGGCAGCCGGTGGGGG - Intronic
1070249675 10:74763203-74763225 CTTTGGGAGGGAGCCCCTGAGGG - Intergenic
1070583505 10:77742976-77742998 CTTGGGGAGGTGGCAGATGGGGG - Intergenic
1070598099 10:77846950-77846972 CTTGTGGAGGTGGGCTCTGCGGG - Intronic
1070844764 10:79513158-79513180 CTGGGGGAGGGGGCCTCTGCAGG - Exonic
1070929040 10:80247153-80247175 CTGGGGGAGGGGGCCTCTGCAGG + Intergenic
1072783618 10:98266486-98266508 CTTGGAGAGGAAGGAGCTGCTGG - Intronic
1072881363 10:99232729-99232751 CTGCGGGAGGGGGCCGCTGCGGG - Intronic
1073970401 10:109041288-109041310 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
1075138248 10:119806856-119806878 GTTGGGGAGGGAGCTGCTGACGG + Intronic
1076604800 10:131682485-131682507 CATGGCGGGGTAGCCGGTGCTGG + Intergenic
1081025220 11:38004407-38004429 CGTGTGCAGGTTGCCGCTGCTGG - Intergenic
1083954554 11:65976372-65976394 CTGGGGGAGGGAGCGGCTGTGGG - Intronic
1084591148 11:70091449-70091471 CTTGGGGAGGGAGGTGCTACTGG - Intronic
1085320835 11:75572993-75573015 CCTGGAGAAGTAGCAGCTGCAGG + Intergenic
1088484279 11:110325676-110325698 GTTGGGGAGGCAGCAGCTGCTGG + Intergenic
1089494787 11:118902583-118902605 CTGGGGGAGGCAGCCGCCCCTGG - Exonic
1091523073 12:1267513-1267535 CTTTGGGAGGCAGACGCTGGAGG + Intronic
1091634444 12:2186414-2186436 CATGGGCAGGTGGCCGCTGAGGG + Intronic
1093122244 12:15284908-15284930 CTTGAGGATGTATCCTCTGCAGG - Intronic
1096538438 12:52289798-52289820 GGTGGGGAGGAAGCCTCTGCAGG - Intronic
1096540341 12:52303566-52303588 GGTGGGGAGGAAGCCTCTGCAGG + Intronic
1099577195 12:84395464-84395486 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1099797821 12:87421238-87421260 CTTGAGCAGGTTGCTGCTGCTGG + Intergenic
1100027475 12:90147700-90147722 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
1101705582 12:107217606-107217628 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
1102945994 12:116988702-116988724 CCTGTGGCAGTAGCCGCTGCTGG + Exonic
1103364507 12:120371360-120371382 CGTGGGTAGGTCGCCACTGCCGG - Intergenic
1103496469 12:121366496-121366518 CTTTGGGAGGTAGAGGCTGGAGG - Intronic
1104282553 12:127391184-127391206 CTTGGGCAGGTTCCCGCAGCTGG - Intergenic
1104970822 12:132529870-132529892 CTTGGGCAGGCAGCTGCTCCAGG - Intronic
1105073833 12:133257150-133257172 CCTGGGGAGGTTGAGGCTGCAGG + Intergenic
1105443863 13:20436191-20436213 CTTGGGAAGGGGGCCGCGGCTGG - Intronic
1105514119 13:21075821-21075843 CTTGGGGAGAACGCCGCCGCCGG - Intergenic
1107343078 13:39430882-39430904 CCTGAGCAGGTTGCCGCTGCTGG - Intronic
1107632574 13:42356922-42356944 CTTGGTGAGGATGCAGCTGCTGG + Intergenic
1109433981 13:62274405-62274427 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1109503106 13:63264084-63264106 CTGGAGCAGGAAGCCGCTGCTGG - Intergenic
1112025697 13:95408973-95408995 CCTGGGGAGGTCGAGGCTGCAGG + Intergenic
1114226033 14:20739807-20739829 CTTGGTTAGTTAGCAGCTGCAGG - Intronic
1114259512 14:21026442-21026464 CTTGGGGGGGCAGTCGGTGCTGG - Intronic
1120920758 14:89753667-89753689 CCTGGGGAGGTTGAGGCTGCAGG - Intergenic
1122756639 14:103985552-103985574 CTTGGGGAGTTTGCCGCTTGTGG + Intronic
1122956766 14:105074829-105074851 CCTGGGGGGGTAGCAGCAGCAGG + Intergenic
1123025239 14:105420869-105420891 CCTGGGGAGGGAGGCGCTGATGG - Intronic
1125525130 15:40369734-40369756 CTTGGGGAGGCAGGGGCTGGTGG - Exonic
1125916791 15:43494822-43494844 CTTGGGGAGGAAGCAGAAGCAGG - Intronic
1127390084 15:58498335-58498357 CCTGGTGATGTTGCCGCTGCTGG + Intronic
1128757595 15:70194090-70194112 ATTGAGGAGGTGGCCGCAGCAGG + Intergenic
1132558457 16:582929-582951 CTTGGGGTGGCAGCCACAGCTGG - Exonic
1132744507 16:1431123-1431145 CTGGGGGAGGCAGACGCTGCTGG + Intergenic
1132930010 16:2454271-2454293 CTTGGGGAGGAAGCAGCAGCAGG - Intronic
1133199544 16:4194734-4194756 CTTGGGGAGGTAGGAGCACCAGG + Intronic
1133648156 16:7783925-7783947 CTTGGGGAGGTTGCTGATGATGG + Intergenic
1134066728 16:11233139-11233161 CTGGGGGTGGCAGCGGCTGCCGG + Intergenic
1136036051 16:27541332-27541354 ACTGGGGATGTAGGCGCTGCTGG - Intronic
1138719760 16:59066172-59066194 CTTGGGGAAGTAGCAGTTTCAGG - Intergenic
1140167524 16:72568912-72568934 CTTGGGTAGGTAGGATCTGCAGG - Intergenic
1141280800 16:82628106-82628128 CCTGGGGTGCTGGCCGCTGCGGG + Intronic
1141693766 16:85610704-85610726 CTAGGGGAGCGAGGCGCTGCCGG - Intergenic
1142115364 16:88353480-88353502 CTGGGGCAGGAAGCCGCTGGTGG - Intergenic
1142849196 17:2696140-2696162 CTTGGTGAGGGAGGGGCTGCGGG - Exonic
1143495753 17:7311854-7311876 CTCGGGGAGGGGGCCTCTGCAGG - Exonic
1144663284 17:17085390-17085412 ATGGGGGAGGTAGCCCCCGCAGG + Intronic
1146265947 17:31452884-31452906 CTGGGGGATGTTGCCCCTGCTGG + Intronic
1146306269 17:31732086-31732108 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
1146798128 17:35797381-35797403 CTTGGGGAGGGAGCTTCTGAAGG - Intronic
1147154586 17:38537422-38537444 CTTGGAGAGGTTGAGGCTGCAGG + Intronic
1149922734 17:60674597-60674619 CTGGAGCAGGTTGCCGCTGCTGG + Intergenic
1150802382 17:68292001-68292023 CTGGGGGAAGTGGGCGCTGCAGG - Intronic
1152343039 17:79735694-79735716 CCTGGGGAGGGAGCCCCTGGAGG - Intronic
1152594718 17:81232591-81232613 CTTGAGCAGGGAGCCGATGCGGG - Intronic
1154258180 18:12804054-12804076 CTTTGGGAGGTAGAGGCTGGAGG + Intronic
1155955839 18:31956120-31956142 CTTGGGGAGGCAGAGGCTGGCGG - Intergenic
1156358688 18:36364756-36364778 CTTGCGGAGGCAGATGCTGCTGG - Intronic
1158324072 18:56295284-56295306 CTGGAGCAGGTAGCAGCTGCAGG - Intergenic
1159312021 18:66721548-66721570 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1160764073 19:799297-799319 CCTGCGGAGGTGGCAGCTGCAGG + Intronic
1160809645 19:1007849-1007871 CTTGGGGGGGTCGCTCCTGCTGG - Exonic
1160812052 19:1017188-1017210 CCTGGTGAGGTGGCTGCTGCAGG - Intronic
1160872457 19:1283485-1283507 CTTTGGGACGCAGCCGCGGCCGG - Intergenic
1160916163 19:1497632-1497654 CGTGGGGATGTTGCTGCTGCTGG - Exonic
1162477316 19:10908281-10908303 CTTGGGCAGGTTTCCTCTGCTGG + Intronic
1162725468 19:12687817-12687839 GTTGGGGAGGGAGCCACAGCAGG + Intergenic
1164178878 19:22802328-22802350 CTTTGGTAGTTAGCAGCTGCAGG + Intergenic
1164684987 19:30160696-30160718 CCTGGGGAGGGAGATGCTGCAGG - Intergenic
1165478267 19:36045343-36045365 CTTGGGGAGTTTGATGCTGCAGG - Intronic
1166365108 19:42274256-42274278 CCTGGGGAGGTGGGCACTGCTGG + Intronic
1166829905 19:45632956-45632978 CGTGGGGCGGCAGCGGCTGCAGG + Exonic
1167494592 19:49810154-49810176 CTGGGGGAGGTGGAGGCTGCCGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
1168287340 19:55341251-55341273 CTTGGAGAGGGAGCAGGTGCTGG + Intronic
928705908 2:33949634-33949656 TTTGGGGTGGTAGCAGGTGCAGG - Intergenic
932458395 2:71864712-71864734 CCTGGGGAGGTAGATGCTGCTGG - Intergenic
932767817 2:74482387-74482409 CTTGGGAAGGGTGCAGCTGCAGG + Exonic
933603228 2:84354486-84354508 CTGGGGGAAGTGGCGGCTGCGGG + Intergenic
935235633 2:101136095-101136117 CTTTGGGAGGCAGAGGCTGCCGG - Intronic
938604424 2:132877565-132877587 CTAGGGGAGGCTGACGCTGCTGG + Intronic
939378296 2:141399478-141399500 TTTGGGGATGTAGCCGCTGGGGG - Intronic
940036852 2:149320574-149320596 CCAGGTGAGGTAGCCGCAGCAGG - Intergenic
941313524 2:163964203-163964225 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
943103394 2:183512789-183512811 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
943185115 2:184598106-184598128 CTTGAGAAAGAAGCCGCTGCTGG + Intergenic
945314818 2:208360326-208360348 CTCGGGGAGGCCGCCGCTCCGGG - Intronic
945803508 2:214462492-214462514 TTTGTGGAGGAAGCTGCTGCTGG + Intronic
946181551 2:217952053-217952075 CTAGGAGAGGGAGCCGCTGAAGG + Intronic
947600035 2:231441514-231441536 CTTGGGGAGGAGGCCGAGGCAGG - Intergenic
948642109 2:239382125-239382147 CTTGGGAAGGCAGCTCCTGCTGG - Intronic
948801359 2:240435084-240435106 CGCGGGGAGGGAGCCGCTGCGGG + Intergenic
1170802058 20:19598658-19598680 CTTGGTGAGGTACCAGCAGCTGG + Intronic
1170893528 20:20395305-20395327 GGTGGGGAGGTGGCAGCTGCAGG + Intronic
1171270311 20:23811844-23811866 CCTGAGCAGGTAGCAGCTGCTGG - Intergenic
1171275875 20:23856044-23856066 CTGGGGGAGGTCTCCTCTGCAGG + Intergenic
1171371536 20:24665467-24665489 CTTGGAGAGGTAGGCGATGAGGG - Exonic
1171487415 20:25494665-25494687 CATGTGGAGGTGGCGGCTGCAGG + Intronic
1172873819 20:38152243-38152265 CCTGGGAAGGAAGCAGCTGCCGG + Intronic
1174205901 20:48838782-48838804 CTTTGGGAGGTGGAGGCTGCTGG + Intergenic
1174590493 20:51640979-51641001 CTTGGGGAGGTTGACGCAGGAGG + Intronic
1179135535 21:38677036-38677058 CTTGGGGTGGTAACTGCAGCAGG + Intergenic
1180200464 21:46220916-46220938 CTTGGGGAGGTAGCCAGGCCAGG + Intronic
1180233485 21:46442279-46442301 CATGGGAAGGTCGCCGCCGCCGG + Intronic
1181352531 22:22268715-22268737 CTTGGGGTGTGAGCTGCTGCTGG - Intergenic
1182524809 22:30908345-30908367 TGTGGGGAGGTGGCCGCTGGCGG + Intergenic
1183324112 22:37182203-37182225 CTTGATGAGGTGGCCGCTGAAGG + Exonic
1183350904 22:37334437-37334459 CTCGGGAAGGTAGCTCCTGCCGG + Intergenic
1185069301 22:48647536-48647558 CTTGGGGAGGTCCCGGCTGTGGG - Intronic
949648489 3:6127109-6127131 CTTGAGCGGGTTGCCGCTGCTGG + Intergenic
951239123 3:20269702-20269724 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
951521661 3:23616206-23616228 CCTGGGGAGGTTGAGGCTGCAGG - Intergenic
954346007 3:49999962-49999984 CTTTTGGAAGTAGCCCCTGCAGG - Intronic
954398099 3:50303564-50303586 CTGGAGGAAGGAGCCGCTGCTGG + Exonic
955351660 3:58197928-58197950 CTTGGGGACGTAGCTGCAGCCGG + Exonic
956136846 3:66107847-66107869 CTTTGGGAGGTTGCGGCTGGAGG - Intergenic
956717102 3:72088260-72088282 CTTGAGTGGGTAGCCTCTGCAGG - Intergenic
957209212 3:77238959-77238981 CTTGGGGAGGTGGGCGGTCCTGG - Intronic
957952892 3:87147796-87147818 CTTTGGGAGGCTGCCGCTGGTGG + Intergenic
959672809 3:108998076-108998098 CTTGGGGAGGTGGACACAGCAGG + Intronic
962388041 3:134948791-134948813 CTTGGGGAGGTAGGTGCCCCAGG + Intronic
968338861 3:197937719-197937741 CTTTGGGAGGTAGAGGCTGGTGG - Intronic
968504296 4:964793-964815 CTTGGCGAGGCAGCCGCAGCGGG + Intronic
968516995 4:1019585-1019607 CCCGGGGAGGAAGCGGCTGCAGG - Intronic
969632257 4:8345612-8345634 CTTGGGGAGGGTGCAGCTGCTGG + Intergenic
973137355 4:46724571-46724593 CTTTGGGTGGTGGCCGCTGCCGG - Intergenic
975048126 4:69828224-69828246 CTTGAGTGGGTTGCCGCTGCTGG - Intronic
977925093 4:102691749-102691771 CTTTGGGAGGTAGAGGCTGGAGG - Intronic
980029850 4:127814806-127814828 CTTTGGGAGGTAGAGGCTGGTGG - Intronic
980713025 4:136594939-136594961 CCTGAGTAGGTTGCCGCTGCTGG - Intergenic
981720279 4:147795047-147795069 CTTTGTAAGGTAGCAGCTGCCGG + Intronic
983033707 4:162836223-162836245 CCTGGGCAGGTTGCCACTGCTGG + Intergenic
984773940 4:183463920-183463942 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
985234110 4:187853902-187853924 CCTGGGGAGGTTGAGGCTGCAGG - Intergenic
987992916 5:25238650-25238672 CTTTGGGAGGTAGAGGCTGATGG + Intergenic
989678977 5:44007096-44007118 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1000014720 5:157266557-157266579 CTCGAGGATGTCGCCGCTGCCGG - Intronic
1002351664 5:178588283-178588305 CCTGGGCAGGCAGCCACTGCTGG - Intronic
1003096786 6:3148490-3148512 GGTGGGGAGGTAGACGCTGCAGG + Intronic
1004160200 6:13206043-13206065 CATGGGGAGGGAGCCGGTGGTGG - Exonic
1004517311 6:16331242-16331264 CTTTGGGAGGTAGAGGCTGGTGG - Intronic
1005320974 6:24653408-24653430 ATTGAGGAGGGAGCCGCTGATGG - Intronic
1006379853 6:33691188-33691210 CCTGGTGAGGTAAGCGCTGCAGG - Intronic
1006898677 6:37486333-37486355 CTTCTGGAGTTAGCCCCTGCAGG + Intronic
1007715743 6:43855081-43855103 CCTGGGGAGGGAGCCTCTGGAGG - Intergenic
1010500456 6:76593622-76593644 CTTGGGGAGGAAACCGCGGCAGG + Intergenic
1016283868 6:142450940-142450962 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1020238486 7:6374551-6374573 CTTTGGGTGGTGGCCGCTGCCGG + Exonic
1021874568 7:25036577-25036599 CTTGGGGAGGTAGCTGTACCTGG + Intergenic
1022513999 7:30964039-30964061 CTGGTGGAGGGAGCCACTGCTGG + Exonic
1025804034 7:64812401-64812423 CTTTGGGAGGCAGAGGCTGCTGG - Intronic
1035494581 7:159312195-159312217 CCTGGGGAGGTTGAGGCTGCAGG + Intergenic
1035694997 8:1589511-1589533 CCTGGGGAGGTTGAGGCTGCAGG - Intronic
1040279862 8:46034653-46034675 CTTTGGGAGGTAGAGGCTGGTGG - Intergenic
1047259300 8:123241452-123241474 CGCGGGGACGTGGCCGCTGCTGG + Intronic
1048072902 8:131040366-131040388 CTTGGGGAGGCAGCCGGAGGAGG + Exonic
1049268399 8:141681598-141681620 CTGGGGCTGGTAGCTGCTGCTGG - Intergenic
1049591884 8:143466433-143466455 GCTGGGGAGGAAGACGCTGCTGG - Intronic
1049686819 8:143942408-143942430 CTGGTAGAGGTAGCCCCTGCGGG + Intronic
1049710990 8:144063218-144063240 CTGGGTGGGGGAGCCGCTGCTGG - Intronic
1050791806 9:9481238-9481260 CTTGGTGAGGTAGAAGCTGGAGG + Intronic
1057453047 9:95182705-95182727 CTTGGTGAGGCAGCCGCTGTGGG + Intronic
1058635953 9:107038848-107038870 TATGGGGAGGCAGCCACTGCTGG - Intergenic
1059234578 9:112750935-112750957 CTCGGGGAGCTCGCCGCGGCGGG + Exonic
1060831989 9:126722818-126722840 CCTGGGGAGGAAGCGGGTGCTGG - Intergenic
1061153890 9:128845621-128845643 GTTGGGGAGGTGGAGGCTGCTGG - Intronic
1062007491 9:134248250-134248272 CTGGGGGAGGTAGCCCCTTCAGG - Intergenic
1062326342 9:136014279-136014301 CTTGGGGAGGGAGCTGAGGCCGG - Intronic
1062403269 9:136381718-136381740 CTTGGGGAAGTGGCCTCAGCAGG - Intronic
1185598659 X:1324248-1324270 CTTTGGGAGGTAGAGGCTGGAGG + Intergenic
1185669189 X:1792329-1792351 CTTGGGGAGGCCGAGGCTGCTGG + Intergenic
1189748645 X:44195990-44196012 CCTGGGGAGGTCGAGGCTGCAGG - Intronic
1194185172 X:90766211-90766233 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic
1194478481 X:94390123-94390145 CTTGAGCAGGTGGCTGCTGCTGG + Intergenic
1194515283 X:94844786-94844808 CTTGGGGAAGGAGCAGCTGTGGG - Intergenic
1196172342 X:112603544-112603566 CTGGGCTAGGTAGCCACTGCTGG + Intergenic
1196663618 X:118294219-118294241 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1199894021 X:152115371-152115393 CTGGGGGAGGTGCCTGCTGCTGG - Intergenic
1200074823 X:153545772-153545794 CTTGGGGAGGTTCCAGCTTCCGG + Intronic
1200100930 X:153688850-153688872 CTGGGGGAGGAGGCCGCGGCGGG - Intronic
1200881140 Y:8212260-8212282 CCTGAGCAGGTTGCCGCTGCCGG + Intergenic
1201530206 Y:14983516-14983538 CTTGAGCAGGTTGCTGCTGCTGG - Intergenic
1201649251 Y:16266758-16266780 CCTGAGCAGGTTGCCGCTGCTGG + Intergenic
1201653558 Y:16318542-16318564 CCTGAGCAGGTTGCCGCTGCTGG - Intergenic