ID: 903644940

View in Genome Browser
Species Human (GRCh38)
Location 1:24889512-24889534
Sequence TGCTAGATAAAGAACTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903644940_903644944 1 Left 903644940 1:24889512-24889534 CCACCCAAGTTCTTTATCTAGCA No data
Right 903644944 1:24889536-24889558 CATAAATCTTCTCAGTCTCATGG No data
903644940_903644945 30 Left 903644940 1:24889512-24889534 CCACCCAAGTTCTTTATCTAGCA No data
Right 903644945 1:24889565-24889587 GAGCAGCTCACACTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903644940 Original CRISPR TGCTAGATAAAGAACTTGGG TGG (reversed) Intergenic
No off target data available for this crispr