ID: 903646201

View in Genome Browser
Species Human (GRCh38)
Location 1:24897691-24897713
Sequence CAGCCCCCACAGCTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903646201_903646206 18 Left 903646201 1:24897691-24897713 CCAACCTCAAGCTGTGGGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 219
Right 903646206 1:24897732-24897754 AAAGTCCAGCCCAGATCAACAGG 0: 1
1: 0
2: 1
3: 17
4: 179
903646201_903646205 -9 Left 903646201 1:24897691-24897713 CCAACCTCAAGCTGTGGGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 219
Right 903646205 1:24897705-24897727 TGGGGGCTGAAGAAACTGGAGGG 0: 1
1: 1
2: 3
3: 25
4: 322
903646201_903646204 -10 Left 903646201 1:24897691-24897713 CCAACCTCAAGCTGTGGGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 219
Right 903646204 1:24897704-24897726 GTGGGGGCTGAAGAAACTGGAGG 0: 1
1: 0
2: 3
3: 28
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903646201 Original CRISPR CAGCCCCCACAGCTTGAGGT TGG (reversed) Intergenic
900245366 1:1633877-1633899 CAGCCCCCACAGCTCGTCCTGGG - Exonic
900256597 1:1701036-1701058 CAGCCCCCACAGCTCGTCCTGGG - Intronic
900329424 1:2126661-2126683 CAGCGGCCACAGCCTGTGGTTGG + Intronic
901192907 1:7423116-7423138 CAGCCCTCACAGCCCCAGGTGGG + Intronic
901511012 1:9718027-9718049 CAGCCCCTAGAGGTTGAGGCAGG - Intronic
901953631 1:12768910-12768932 CAGCTCCCAGAGCCTGGGGTTGG - Intergenic
902478223 1:16699158-16699180 CAGGCCACACAGCTAGAGGGTGG + Intergenic
903006517 1:20302491-20302513 TAGCCCCCAGAACTTGAGGCAGG - Intronic
903618826 1:24682961-24682983 CAGAGCCCAGAGCTTGAGGTTGG + Intergenic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
903658223 1:24961713-24961735 AATCCTCCACAGCCTGAGGTAGG + Intronic
905110375 1:35590374-35590396 CAGCCCCCTCCCCTGGAGGTTGG + Intronic
905672938 1:39804369-39804391 CACCACGCCCAGCTTGAGGTGGG + Intergenic
906110989 1:43321815-43321837 CAGCCCCCACTGAGGGAGGTTGG - Intronic
906401540 1:45508325-45508347 CAGCCTCCACATCTTGTCGTTGG - Exonic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908892610 1:68863420-68863442 CAGCTCCCAAAGCCTCAGGTGGG + Intergenic
910379403 1:86609613-86609635 CAGCCACCACAGCTAGGGTTGGG + Intergenic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
912230755 1:107790081-107790103 AAGCCCCCCCAGCTTGATATGGG + Intronic
915401180 1:155623053-155623075 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
915527851 1:156487184-156487206 CAGCTCCCCCAGCATGAGGCGGG - Intronic
918043244 1:180925971-180925993 CAGCCCCCACTGCTTGCAGATGG + Intronic
920052886 1:203174187-203174209 CAGCCCCCACGCCTTGAGAAAGG - Intronic
920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG + Intergenic
920673056 1:208019206-208019228 CAGACCATACAGCTTGAGGATGG + Intergenic
922977937 1:229800769-229800791 CAATCCCCACTGCTGGAGGTGGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
924876011 1:248105348-248105370 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1064052944 10:12073752-12073774 CAGGCCCCACAGCTTGGCATGGG + Intronic
1064594977 10:16934818-16934840 CAGCTCCAACAGCCTGAGTTAGG + Intronic
1070839745 10:79475853-79475875 GAGCTCCCTCAGGTTGAGGTTGG - Intergenic
1070892881 10:79955156-79955178 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1071670466 10:87604429-87604451 CAGCCACCACTACTTGAGTTTGG - Intergenic
1072264796 10:93716795-93716817 TAACCCCCACTGCTGGAGGTGGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1075281178 10:121139744-121139766 CAGTCCCCAAATCTTGAGGAAGG + Intergenic
1076587445 10:131559350-131559372 CGGGCCCCACAGTTTGAGGCTGG + Intergenic
1077858528 11:6154097-6154119 CAGCCCCCACTGCTGGTGGCAGG + Intergenic
1078348550 11:10573476-10573498 CAGCTCCCACTGCTTCAGGCTGG + Exonic
1079811689 11:25005119-25005141 CACCCCCTACAGCTTGAAGGGGG + Intronic
1080461553 11:32459144-32459166 CAGCCCCACCAGCTTGAGAGTGG + Intergenic
1083708391 11:64532107-64532129 CAGAGCCCACAGCTTGACATGGG - Intergenic
1085117938 11:73946869-73946891 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1088754663 11:112876025-112876047 CTGCCCACACCCCTTGAGGTGGG + Intergenic
1089531170 11:119130821-119130843 CAGCCCCCACTGTTTCAGCTTGG - Exonic
1089606282 11:119643488-119643510 AAGACCCCACAGCCTGAGGCAGG - Intronic
1091049256 11:132352712-132352734 CAGCCCCCACAGGCTCAGGCCGG + Intergenic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1093567906 12:20630199-20630221 CAGCCCACGCAGCTTGGGGTAGG + Intronic
1094043611 12:26143749-26143771 TAACCCCCACAGCAGGAGGTGGG + Intronic
1095115216 12:38344530-38344552 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098082223 12:66799591-66799613 CATCCCCCACAGACTGAGGAAGG + Intronic
1098421012 12:70297981-70298003 CAACTCCCAGAGGTTGAGGTGGG - Intronic
1102066828 12:109984047-109984069 CAGGCCACACAGCTTGAAGTGGG - Intronic
1102481030 12:113223362-113223384 CAGAGCCCACAGCTTGAGGAAGG + Intronic
1103988295 12:124781448-124781470 CAGGCCCTACAACTTGGGGTTGG - Intronic
1105441849 13:20421686-20421708 CAGCTCCCTCAGTTTGAAGTTGG - Intronic
1105665476 13:22551567-22551589 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1105669833 13:22600806-22600828 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
1107013318 13:35689314-35689336 GTGCCCACACAGATTGAGGTTGG - Intergenic
1107889954 13:44905463-44905485 CAGCCACCACAGCTAGAATTAGG - Intergenic
1108096262 13:46904484-46904506 CATCCCCCACAGCATGAAGTGGG - Intergenic
1110833123 13:80054249-80054271 CAGCCCCCAGAGGTGGAGGTTGG - Intergenic
1113427313 13:110219168-110219190 CTGCCACCACAGTTTGAGGGGGG + Intronic
1116452989 14:45084731-45084753 CAGCACCCACAGCTTTTGGCAGG + Intronic
1117119641 14:52553338-52553360 CAGCCGCCACAGCTGCAGGTAGG - Exonic
1117762617 14:59046879-59046901 GAGCCCTCACAGCTTGTGCTGGG - Intergenic
1118592917 14:67414348-67414370 CAGCCACCACAGCCTGGGGAAGG - Intergenic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121939375 14:98055260-98055282 CAGCCTCCACATCTTGGGGAAGG + Intergenic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122061743 14:99140568-99140590 CGTGCCCCACAGCTTGAGGCTGG - Intergenic
1122132468 14:99612824-99612846 CAGCCCCCACAGCCTCTGGACGG + Intergenic
1122869366 14:104629039-104629061 CAACACCGACAGCTTGAGCTTGG - Intergenic
1122983846 14:105203316-105203338 CAGCCCCCACAGCTGGGTGATGG - Intergenic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1126661851 15:51040023-51040045 CAGGCCGCACAGCAGGAGGTGGG + Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1132196870 15:99920036-99920058 TAGCCCCCAGAGCTGGGGGTGGG - Intergenic
1132616138 16:841994-842016 CAGGCCCCAAAGCTGAAGGTTGG - Intergenic
1133890743 16:9876567-9876589 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1134914850 16:18060898-18060920 CAGCCCCCACAGCATGGAGGGGG - Intergenic
1135860232 16:26049694-26049716 CAGATTCCACAGCTTGAGGCTGG + Intronic
1136406598 16:30051773-30051795 CAGCCACCTCTGCCTGAGGTTGG + Intronic
1136988359 16:35134805-35134827 CAGCCCCAGCAGCTTTTGGTTGG + Intergenic
1137745829 16:50819338-50819360 CTGGCCTCACAGCTTGAGCTGGG + Intergenic
1138060670 16:53886909-53886931 GAGCCACCACAGCTTCAGGCTGG - Intronic
1138162304 16:54765801-54765823 TCGCCACAACAGCTTGAGGTAGG - Intergenic
1138822572 16:60279554-60279576 CAGACCGCACATCTTGATGTTGG - Intergenic
1140682504 16:77399122-77399144 CATCCCCCACACCTGGTGGTGGG - Intronic
1141367274 16:83455382-83455404 CATCCCCCAGAGCCTCAGGTGGG - Intronic
1141572177 16:84940845-84940867 CAGCCCCCACAGGCCGAGGCTGG - Intergenic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142127162 16:88415880-88415902 CTGCCGCCCCAGCTTGAGGAAGG - Intergenic
1143188048 17:5022405-5022427 CAGCTCCCGCATCTTGAGGGCGG - Exonic
1143595543 17:7911635-7911657 CAGGCCCCAGCGCTTGAGCTGGG - Exonic
1147057240 17:37844069-37844091 CAGCCCCCAGAGGTTGGGGTGGG - Intergenic
1147695261 17:42347619-42347641 TAACCCCCACTGTTTGAGGTGGG + Intronic
1148458089 17:47821595-47821617 CAGACCCACCAGCTTCAGGTGGG + Intronic
1149996880 17:61410295-61410317 CAGCTCCCACTGCTAGAAGTGGG - Intergenic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1152475616 17:80516210-80516232 CATTCCCCAGAGCTGGAGGTGGG + Intergenic
1152898389 17:82926291-82926313 CAGACCCCACACCATGAGATAGG - Intronic
1154171814 18:12057624-12057646 CAACTCCCACACCTTGAGGGTGG + Intergenic
1155512494 18:26592430-26592452 CAGACCCCACAGCTTGGTGATGG - Intronic
1158137325 18:54222373-54222395 CTGGCCCCACAGCCTGAGGGAGG + Intronic
1160844403 19:1160095-1160117 CAGCACCCACAGCCAGAGGGCGG - Intronic
1160986594 19:1841826-1841848 CTGCCCCCAGAGCCTGAGATGGG - Intronic
1161671778 19:5616127-5616149 CAGCCCCCAGAGCATGCTGTAGG - Exonic
1162125894 19:8499362-8499384 AAGCCCCTGCAGCCTGAGGTCGG - Exonic
1163830053 19:19543295-19543317 CAGTCCCCGCAGCTCCAGGTGGG - Exonic
1165128291 19:33616513-33616535 CGCTCCCCACAGCCTGAGGTGGG - Intergenic
1165130872 19:33631149-33631171 CTGCCCACACAGGTTGAGCTGGG + Intronic
1165824339 19:38697231-38697253 CAGCCTCCACAGGGTGGGGTGGG + Intronic
1166431591 19:42732550-42732572 CAGCGTCCACAGCTTGTGATGGG - Intronic
1166434707 19:42757768-42757790 CAGCGTCCACAGCTTGTGATGGG - Intronic
1166473063 19:43096874-43096896 CAGCTTCCACAGCTTGTGATGGG - Intronic
1166733312 19:45070654-45070676 CAGCCCCTCCAACTGGAGGTGGG - Intronic
1202712244 1_KI270714v1_random:24986-25008 CAGGCCACACAGCTAGAGGGTGG + Intergenic
925595898 2:5555404-5555426 CTGCCCCCACAGCCTGGGCTGGG + Intergenic
929592764 2:43157851-43157873 CAGCCCCCTCAGGTTGTGGGGGG - Intergenic
930998227 2:57748714-57748736 CAAGCCCCACAGCTGTAGGTGGG - Intergenic
932574360 2:72954645-72954667 CAGCCCCCACAGCTGCAGGGAGG + Intronic
932594279 2:73084447-73084469 CTGCCCCCACCGCTTGGGGGTGG - Intronic
933633516 2:84682367-84682389 CGGCCCCAACATTTTGAGGTAGG - Intronic
937223858 2:120357063-120357085 CAGACCCCACAGGAAGAGGTGGG - Intergenic
937327277 2:120998142-120998164 CAGTCCCCACATGTTGTGGTAGG + Intergenic
938899780 2:135790254-135790276 CAGCCCTAACAACTTGAGATGGG - Intronic
940087149 2:149873076-149873098 TGGCCCCCAGAGCTTGAAGTTGG - Intergenic
940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG + Intronic
944034565 2:195278187-195278209 GAGCCCACACAGATTGAGGGTGG + Intergenic
946277482 2:218642446-218642468 CAGCACCCACGGCTTGAGTGTGG - Exonic
946519636 2:220450862-220450884 CAGCCCACACTGGTTGATGTGGG + Intergenic
947333063 2:229050717-229050739 CTACCCCCAGAGCTTGAGATGGG - Intronic
948168516 2:235881648-235881670 CAGGCCCCACACCTTGAGCTGGG - Intronic
948413952 2:237787204-237787226 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1169518564 20:6345605-6345627 CAGTCCCCAAAGTTGGAGGTGGG - Intergenic
1172069967 20:32249494-32249516 CAGTTACCACAGGTTGAGGTAGG - Intergenic
1172421777 20:34824918-34824940 CAGCCCTGACAGCCTGAGCTTGG + Intronic
1172992130 20:39044387-39044409 CAGCTCCCACACCTACAGGTAGG - Intergenic
1175391911 20:58632810-58632832 GAGCCCCCACTGATTGGGGTCGG + Intergenic
1175866979 20:62184022-62184044 CAGCCTCCACTGCTTTAGATGGG + Intronic
1175907871 20:62390565-62390587 CAGCCACCACAGCGTCAGGGTGG - Exonic
1176173866 20:63708491-63708513 CCGACCCCACAGCCTGAGGGCGG - Intronic
1178441835 21:32604689-32604711 CAGCCCCCTCAGCATGGGGCAGG + Intronic
1179193431 21:39142909-39142931 TAGTCCCCACATGTTGAGGTGGG + Intergenic
1179975721 21:44864819-44864841 AAGCCTCCACGGCATGAGGTGGG - Intronic
1180981043 22:19878150-19878172 GAGCCCCCACAGCTGGTGCTGGG - Exonic
1182211934 22:28684086-28684108 CTGGCCCCCCAGCTAGAGGTGGG - Intergenic
1183333549 22:37234167-37234189 CTGCCCCCACAGCTGGCGGAAGG + Intronic
1183350580 22:37332595-37332617 CAGCCCCCACAGCAGGAAGCAGG + Intergenic
1184853937 22:47136340-47136362 CAGCCCCAGGATCTTGAGGTTGG - Intronic
1184920614 22:47603267-47603289 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920636 22:47603345-47603367 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920658 22:47603423-47603445 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920680 22:47603501-47603523 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1185024794 22:48402764-48402786 CAGCCCACACAGCCTGACGTGGG + Intergenic
1185053159 22:48564211-48564233 CAGCGCCCGCAGCCTGAGGATGG + Intronic
951102204 3:18702549-18702571 CAGCCACCACTGCTGGATGTGGG - Intergenic
952840438 3:37641150-37641172 CCGGCCACACAGCATGAGGTGGG + Intronic
953413458 3:42702612-42702634 CGGACCCCAGAGCCTGAGGTGGG - Exonic
953930571 3:47003779-47003801 CAGAGCCTACAGCGTGAGGTGGG + Intronic
954466293 3:50657001-50657023 CAGCCCTCCCAGCTTCAGGTGGG - Intergenic
956198788 3:66683855-66683877 CAGTTCCCACAGGTAGAGGTTGG - Intergenic
956683745 3:71805207-71805229 CAACCCCCAATGCTGGAGGTGGG + Intergenic
956930949 3:74042367-74042389 CAGCCCACAGAGGTTGATGTTGG - Intergenic
958598412 3:96260619-96260641 CAGCACCCACAGCCAGAGCTTGG + Intergenic
961391774 3:126556356-126556378 CAGCCCCCACAGGCTGCTGTGGG - Intronic
964405420 3:156343546-156343568 CAGCCTCCGCAGCTTGTGGGAGG + Intronic
964974050 3:162598907-162598929 TAGCCCCCACGGCCTGATGTTGG + Intergenic
965666133 3:171095347-171095369 CACACACCACAGGTTGAGGTTGG + Intronic
966721114 3:183063769-183063791 CAGACCCCACCGCTTTGGGTCGG - Intronic
967979871 3:195059332-195059354 CTGCCCCCTCAGCTGGAGCTGGG - Intergenic
968726751 4:2251400-2251422 CCAGCCCCACAGCCTGAGGTGGG + Intronic
972884487 4:43469152-43469174 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
973903227 4:55499619-55499641 CAGGCCGCACAGCAGGAGGTAGG - Intronic
975744783 4:77465425-77465447 CTGGCCCCACAGCTTGACCTTGG - Intergenic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
977680904 4:99797854-99797876 CAGGACCCACAGCTGCAGGTCGG + Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
986415833 5:7527127-7527149 CAGCCACCACAACATGAGGTGGG - Intronic
988236168 5:28548078-28548100 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
989380893 5:40808474-40808496 CATCCCCCAGGGCCTGAGGTTGG - Intergenic
990247119 5:53874201-53874223 CAGGCCTCACAGCAGGAGGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994841733 5:104932632-104932654 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
997316627 5:132942089-132942111 CAGACCCCACAGGTTGAGTGAGG + Intronic
1001564189 5:172688929-172688951 GAGACCCCACAGCTTGTGGCTGG - Exonic
1001789999 5:174448054-174448076 AAGCCCCAACACCTTGATGTGGG + Intergenic
1002321669 5:178379982-178380004 GAGGCCCCACAGCCTCAGGTTGG + Intronic
1002369744 5:178742175-178742197 CAGCCCCCACAGCCTGGTGTTGG - Intergenic
1003122139 6:3327143-3327165 CAGCTCCCACACCTTGAAGATGG + Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1006140925 6:31929197-31929219 CAGGCCCCACAGATTGTTGTAGG + Intronic
1006521168 6:34572081-34572103 CAGCCCCCACAGCGGGAGGGAGG + Intergenic
1007726410 6:43918625-43918647 CAGGCCCCTCACCATGAGGTAGG - Intergenic
1009423926 6:63493443-63493465 CAACTCCAACAGTTTGAGGTTGG + Intergenic
1009905754 6:69867894-69867916 CATCGGCCACAGCTTGAGATTGG + Intronic
1017770231 6:157638912-157638934 CAGCGCCCACAGCCTGAGCAAGG + Intronic
1019364326 7:624093-624115 CAGCACCCGCAGGTTTAGGTTGG + Intronic
1022010209 7:26302272-26302294 GGGCCCACACAGCTTGAGATGGG - Intronic
1022443397 7:30451632-30451654 CAGCCCGCACAGGAAGAGGTTGG + Exonic
1023110854 7:36809226-36809248 CAGCCCCCACCTCTTGTGTTTGG + Intergenic
1023999240 7:45180099-45180121 CAGCCGCCAGAGCTTGAGAAAGG - Intronic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1029445202 7:100608064-100608086 CAGCCCGCACAGGTTGAGAGGGG - Exonic
1029580891 7:101436065-101436087 AGGCCCCCACTGCTTGGGGTGGG - Intronic
1030175080 7:106644184-106644206 CAGTCACCACAGCTTGATTTTGG - Intergenic
1032672426 7:134097672-134097694 CTACCCCCACAACTTGATGTGGG + Intergenic
1034163238 7:149007420-149007442 CAGACCCCACAGCTCCTGGTGGG - Intronic
1034457807 7:151180927-151180949 CAGCCCCCATACCTTGGGGAGGG + Exonic
1035113666 7:156505415-156505437 AAGCACCCACAGCGTGAGGAAGG - Intergenic
1036285201 8:7438372-7438394 CATGCCACACAGCATGAGGTGGG + Intergenic
1037356366 8:18023956-18023978 CTGCCCTCTCAGCTTGAGGGTGG - Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1039652687 8:39359423-39359445 CAATCCCCACTGCTGGAGGTGGG + Intergenic
1039887130 8:41661327-41661349 CAGCCACCCCAGCATGATGTGGG - Intronic
1042414263 8:68501131-68501153 CAGCGCCCTCAGCTTGAACTTGG - Intronic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1048570155 8:135645961-135645983 CAGCCATCACAGCTTCAGGCAGG - Intronic
1048969715 8:139638693-139638715 CCGGCCCCAGAGCCTGAGGTGGG - Intronic
1060184759 9:121557619-121557641 CAGCCCCCAGAGCTTGGCCTTGG - Intergenic
1060403637 9:123362228-123362250 CATCCTCCAGAGGTTGAGGTCGG + Intronic
1061274094 9:129559463-129559485 CAGTCCCCCCAGCTTGCTGTGGG - Intergenic
1061601507 9:131673382-131673404 CAGGCCCAAAAGCTAGAGGTTGG + Intronic
1062601684 9:137321182-137321204 CTGCCCCCACAGCCTCAGGCTGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1195325088 X:103751982-103752004 AATACCCCACAGCTTGGGGTTGG - Intergenic
1198030594 X:132750140-132750162 CTGGCCCCACAGATTGTGGTGGG - Intronic
1200078271 X:153562652-153562674 CAGCCCACAGAGCTCGATGTGGG - Intronic
1201585489 Y:15556003-15556025 CAGCCCACACAGCTAGATGCAGG + Intergenic