ID: 903646413

View in Genome Browser
Species Human (GRCh38)
Location 1:24898760-24898782
Sequence GAGTGGTTTTTGAAGTCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903646407_903646413 3 Left 903646407 1:24898734-24898756 CCAAACTGAGCAGGGCAAAGCTT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 87
903646406_903646413 7 Left 903646406 1:24898730-24898752 CCAACCAAACTGAGCAGGGCAAA 0: 1
1: 0
2: 1
3: 18
4: 143
Right 903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903646413 Original CRISPR GAGTGGTTTTTGAAGTCGGT GGG Intergenic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
917723941 1:177812245-177812267 GAGTGGGTTCTAAAGTGGGTGGG - Intergenic
918639881 1:186826967-186826989 CAGAGGTTTTTGAAGTCAGTAGG + Intergenic
919382359 1:196874816-196874838 CAGTGGCTTTTGGAGTCCGTGGG - Intronic
1064579465 10:16779149-16779171 GATGGGTTTTTGAAGTCAGCGGG - Intronic
1068487716 10:57680979-57681001 CAGTAGTTTTTGAGGTGGGTAGG - Intergenic
1072188014 10:93060667-93060689 GAGTGGTGATTGGAGGCGGTGGG - Intergenic
1077610546 11:3641197-3641219 GAAAGGTTCTTGCAGTCGGTGGG + Intronic
1077716381 11:4585137-4585159 GAGTGGATTTTTAAGTCTATGGG + Intergenic
1080539634 11:33254048-33254070 GAGGGGTTTTTGAAGAGGCTAGG + Intergenic
1084214460 11:67639930-67639952 GAGTGGTTCTTGAGGACGGCTGG + Intergenic
1088321650 11:108560447-108560469 GAGTGGTTTGTCAGGTCAGTTGG - Intronic
1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG + Intronic
1094002465 12:25709930-25709952 GTGAAGTTTTTGAATTCGGTTGG - Intergenic
1095340875 12:41087162-41087184 GTGTGGTTTTTTAAGCCCGTCGG + Intergenic
1100464212 12:94831213-94831235 GAGGGGTTTTTGAACTTGGCTGG - Intergenic
1103303683 12:119947477-119947499 GAGTGATTTTTGAGGACAGTGGG - Intergenic
1103513445 12:121490907-121490929 GAGTGGTATTTGATCTGGGTCGG - Intronic
1115523890 14:34259980-34260002 GTGTTGTTTTGGAAGTCTGTGGG - Intronic
1118830981 14:69432320-69432342 GAGTGGTTTTTCATGTTTGTTGG + Intronic
1121788798 14:96683288-96683310 GTGTGGATTTTGGAGCCGGTTGG - Intergenic
1125226818 15:37405154-37405176 GAGCGGTTTTTTAAGCCGGTCGG + Intergenic
1125228730 15:37427458-37427480 GAGCGGTTTTTTAAGCCCGTCGG - Intergenic
1129449571 15:75643214-75643236 GAGTGGTATTTGAAGTCATTCGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1132268864 15:100504974-100504996 GACTGGTTTCTCAAGTCTGTAGG - Intronic
1132758381 16:1496920-1496942 GAGTGAGTTTTGCTGTCGGTTGG + Intronic
1136542511 16:30936027-30936049 AAGTGGTTGGTGCAGTCGGTAGG - Intronic
1140711630 16:77683792-77683814 GAGTGGTCTTGGAAGGAGGTGGG - Intergenic
1144038145 17:11385642-11385664 GAGTGGCTTTTGAAGCTGGGAGG + Intronic
1152212259 17:79009021-79009043 GAGGGGTATTTGAAGTCAGAAGG + Intronic
1153028781 18:694087-694109 GAGAGGTTTTGGCAGTAGGTAGG - Intronic
1153636197 18:7116135-7116157 GAGTGGTTTTTGGAGAAAGTGGG - Intronic
1158323279 18:56287132-56287154 GGGTGTGTTTCGAAGTCGGTTGG - Intergenic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1164682618 19:30145735-30145757 GAGAGGTTTTAGCAGTGGGTTGG + Intergenic
1168332919 19:55580259-55580281 GGGTGGGATTTGAAGCCGGTAGG + Intronic
927833762 2:26374414-26374436 GAGTGTTTGTTGAAGTGGTTGGG + Intronic
929060451 2:37918979-37919001 TAGTGGTTTCTGCAGTAGGTTGG + Intergenic
931999343 2:67869642-67869664 GAGTGGAATTTGAAGACAGTGGG - Intergenic
938188690 2:129255376-129255398 GAGTGGATGTTTAAGTGGGTGGG - Intergenic
1172760794 20:37320060-37320082 GTGTGGATTTTGATGTCTGTGGG + Intergenic
1175379185 20:58550976-58550998 GAGTTGTTTGTGAAGTCTGGGGG + Intergenic
1175677620 20:60960365-60960387 GAGTGGTTTCTGAAGTCACAAGG - Intergenic
1179103880 21:38381124-38381146 CAGTGGGCTTTGAAGTCGGCAGG - Exonic
1180198260 21:46209988-46210010 GAGTGGATTTTTATGCCGGTGGG - Intronic
1184382518 22:44154475-44154497 GTGTGGTTTATGCAGTCTGTTGG + Intronic
953606601 3:44416786-44416808 GAGTGGTCTTTGCTGTGGGTGGG - Intergenic
954307171 3:49734441-49734463 GAGTGGCATTTGAAGTTGCTGGG - Intronic
954754685 3:52832745-52832767 GAGGGGTTTTTGAGGTCCCTAGG + Intronic
955217779 3:56998603-56998625 GAGTGGTCTGTGAAGTCCCTGGG - Intronic
955872106 3:63450255-63450277 GTGCGGGTTTTGAAGTCGGATGG + Intronic
956991103 3:74766627-74766649 GAATATTTTTTGAAGTAGGTGGG + Intergenic
957090651 3:75726828-75726850 CAGTGGTTTTTGGTGTCTGTGGG - Intronic
962659699 3:137588970-137588992 GAGTGGTCTTTGCAGCTGGTAGG + Intergenic
965581882 3:170277314-170277336 GAGTGGTTTTTCATGTGTGTTGG - Intronic
966158787 3:176946717-176946739 GTGTGGTTTTTGAAGTTGCAGGG - Intergenic
966731391 3:183154158-183154180 CAGTGTTTTTTGTAGTCGCTGGG + Exonic
969602179 4:8182951-8182973 GAGTGGGTTTTGAAGGAGGCAGG + Intronic
970129651 4:12853359-12853381 GATTTGTTTGTGAAGTCGTTAGG - Intergenic
970923956 4:21428490-21428512 TAGTGGTTTTTGAAGCCTGCAGG - Intronic
972669419 4:41200005-41200027 GAGTAATTCTTGAAGTGGGTTGG - Intronic
974508982 4:62812213-62812235 GAATTGTTTTTGAAGTGGATGGG + Intergenic
982742738 4:159074641-159074663 GGGTGGTTTTTGCAGTGAGTGGG + Intergenic
984952734 4:185019083-185019105 GAGTGGTTTGGGAAGGGGGTGGG + Exonic
987958079 5:24765867-24765889 TACTGGTATTTGAAGTAGGTTGG + Intergenic
991518153 5:67463156-67463178 GAGTGGTTTATGAGGGCAGTGGG - Intergenic
992062365 5:73066674-73066696 GAGTGGTTCTTTCAGTGGGTAGG - Intronic
994145385 5:96389073-96389095 GAATGGTTTTTGCAGTGGGGTGG + Intergenic
995650643 5:114363511-114363533 AAGTGGTTCTGGAAGTCGGTGGG + Intronic
995778853 5:115754980-115755002 AAATTGTTTTTGAAGTCTGTTGG + Intergenic
1000586544 5:163106287-163106309 CAGTGGGTTTTGAATTCAGTAGG - Intergenic
1002477093 5:179473339-179473361 GAGTGGCTGTTGATGTCGCTGGG - Intergenic
1006621787 6:35370420-35370442 GAGTGCCTTTTGAAGTCGTCAGG + Intronic
1017153984 6:151306751-151306773 GAGCTGCTTTTGAAGTTGGTGGG + Intronic
1027900744 7:84111369-84111391 GAGTGCTTTATGTAGTCAGTTGG + Intronic
1028461812 7:91102700-91102722 GTTTGGTTTTTGAAGTGGGAAGG - Intronic
1028537837 7:91909387-91909409 GCGCGGTTTTTTAAGCCGGTCGG + Intergenic
1045555854 8:103213782-103213804 CAGTGGATTTTGAAGGGGGTGGG - Intronic
1045911421 8:107415024-107415046 GAGTGGTTGCTGAACTAGGTAGG + Intronic
1048267100 8:132997421-132997443 CAGTGGTATTTGAAGTCGTAGGG + Intronic
1053565055 9:39241059-39241081 GAGTGATTATGGAAGTGGGTAGG - Intronic
1054132095 9:61377979-61378001 GAGTGATTATGGAAGTGGGTAGG + Intergenic
1057715548 9:97492455-97492477 GTGTGGTTTTTGAAGTCAAAAGG + Intronic
1058772293 9:108247623-108247645 GAGTGGTGTGTGCAGTGGGTTGG - Intergenic
1186950065 X:14614642-14614664 GAGTGAATTTTGAAGGCAGTAGG - Intronic
1188382336 X:29510657-29510679 GAATGGTTTTTGCAGTCTATGGG - Intronic
1189317415 X:40065857-40065879 GAGTAATATTTGAAGTGGGTTGG - Intronic
1202273482 Y:23092971-23092993 GATTGGTATTTGCAATCGGTAGG + Intergenic
1202292544 Y:23327711-23327733 GATTGGTATTTGCAATCGGTAGG - Intergenic
1202426479 Y:24726715-24726737 GATTGGTATTTGCAATCGGTAGG + Intergenic
1202444310 Y:24943371-24943393 GATTGGTATTTGCAATCGGTAGG - Intergenic