ID: 903646609

View in Genome Browser
Species Human (GRCh38)
Location 1:24899942-24899964
Sequence TTTTGTCAGGGGATGGGGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1465
Summary {0: 1, 1: 0, 2: 19, 3: 158, 4: 1287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903646600_903646609 7 Left 903646600 1:24899912-24899934 CCTTACAGACTCAGTACGGCTGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG 0: 1
1: 0
2: 19
3: 158
4: 1287
903646598_903646609 17 Left 903646598 1:24899902-24899924 CCACTTTGGGCCTTACAGACTCA 0: 1
1: 0
2: 0
3: 13
4: 110
Right 903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG 0: 1
1: 0
2: 19
3: 158
4: 1287
903646597_903646609 18 Left 903646597 1:24899901-24899923 CCCACTTTGGGCCTTACAGACTC 0: 1
1: 0
2: 1
3: 7
4: 98
Right 903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG 0: 1
1: 0
2: 19
3: 158
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903646609 Original CRISPR TTTTGTCAGGGGATGGGGGA TGG Exonic
901285719 1:8077126-8077148 TTTTAGCAGGGGTTGGGGGAGGG + Intergenic
901457846 1:9373661-9373683 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
901536540 1:9886056-9886078 TTTTGTTACAGTATGGGGGATGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901921765 1:12541871-12541893 TTTTGTCTGGTGGTGGGGAAAGG - Intergenic
902169102 1:14596612-14596634 GTTTGTCAGGGGCTGTGGGGAGG - Intergenic
902414046 1:16228540-16228562 TTTAGTCAGGGGTGCGGGGAGGG - Intergenic
902435765 1:16397366-16397388 TTGTGTCGGGGGAGGCGGGAGGG + Exonic
902552231 1:17225944-17225966 TGTTGTCTGGGGAGTGGGGAAGG + Intronic
902553271 1:17231883-17231905 TGGGGTGAGGGGATGGGGGAGGG - Intronic
902660771 1:17901679-17901701 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
902669060 1:17959590-17959612 ATTTCTCAGGTGATGGAGGATGG + Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
902932625 1:19742178-19742200 TTTTGTCAGAGGAGCCGGGAAGG - Intronic
903262175 1:22137222-22137244 GTTTGCCAGGACATGGGGGAGGG + Intronic
903341487 1:22657568-22657590 GGTTGTCAGGGGCTGGGGGAAGG + Intronic
903489583 1:23718144-23718166 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903815795 1:26063515-26063537 CTTTATCAGGGGATGGAGGCAGG - Intronic
903869037 1:26419070-26419092 TTTTTGGAGGGGATGGGGAAGGG + Intronic
903951837 1:27000175-27000197 TCTTGGCTGGGGATGGGGTAGGG - Exonic
904381722 1:30115836-30115858 TTTTCTCAGTGGAGGGGAGATGG - Intergenic
904466180 1:30708907-30708929 ATTTGGCAGGGGGTGGGGGTGGG - Intergenic
904483435 1:30808069-30808091 TCTTCTCAGGAGGTGGGGGAGGG + Intergenic
904965697 1:34370896-34370918 CTTCCTCAGGGGATGGGGGCGGG - Intergenic
905842399 1:41193511-41193533 CTTTGCCAGGGGTTGGGGGGGGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906938103 1:50232220-50232242 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
907256328 1:53181801-53181823 TTTTGTCAGGGGAGGGGACGGGG - Intergenic
907318726 1:53589390-53589412 GTTTCTCAGGGGCTGGCGGAGGG + Intronic
908699823 1:66886938-66886960 CTTAGTCTGGGGATGGGGGGTGG - Intronic
908912602 1:69089475-69089497 TTTTTTAGGGGGATGGGGAAGGG + Intergenic
908953077 1:69586373-69586395 TTTTGGCAGGGGGTGGGGCAGGG + Intronic
909139274 1:71843216-71843238 TTGTGGCAGGGGATGGAGAAAGG + Intronic
909454469 1:75834778-75834800 TGGGGTCAGGGGATGGGGGAGGG + Intronic
909654639 1:78017670-78017692 TGTTTTCAGGGGCTGGAGGAAGG - Exonic
910116074 1:83733559-83733581 TTTTTTGAGGGGATGGGGAGAGG - Intergenic
910164672 1:84313545-84313567 TTTTATCCTGGGATGGGAGAAGG + Intronic
910204512 1:84734763-84734785 TGTGGTCAGGGGCTGGAGGAAGG + Intergenic
910263324 1:85312768-85312790 TTGGGTCGGGGGGTGGGGGAAGG - Intergenic
910546519 1:88425018-88425040 TGTTGTAGGGGGATGGGAGAGGG - Intergenic
910976900 1:92916093-92916115 GGTTGTCAGAGGCTGGGGGAGGG + Intronic
911065832 1:93787152-93787174 TCTTGTCAGGGGAGGGAGCAGGG + Intronic
911293451 1:96084764-96084786 ATTTGTCTGGGGATGGGGACAGG - Intergenic
911397274 1:97326264-97326286 TTTTGGCAAGGGCTGGGGAAGGG + Intronic
911660678 1:100498285-100498307 TTTTGTCAGAGGAGGGGACAAGG + Intronic
911733171 1:101310453-101310475 TTCTCTCAGGGGAGGGGGGCAGG + Intergenic
911767184 1:101691975-101691997 GGGTGTCGGGGGATGGGGGAGGG - Intergenic
912062586 1:105691040-105691062 ATTTTTCATGGGATAGGGGAGGG - Intergenic
912098022 1:106169244-106169266 TGTTGTCAGGTGGTGGGAGAGGG + Intergenic
912202053 1:107469359-107469381 ATTTGGCAGGGAATGGGAGAGGG - Intronic
914418348 1:147505246-147505268 TTCTGTGGGAGGATGGGGGAGGG - Intergenic
914906451 1:151749852-151749874 TTTTGGCATGGGTTGGGGTAGGG + Intergenic
915079820 1:153344492-153344514 TGTCGTCAGGGGCTGGGGGAAGG + Intronic
915406377 1:155663010-155663032 TTTTGTTGGGGGATGGGGCGGGG - Intronic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
916176035 1:162039473-162039495 TTTTGTGTGGGGATGGGGCAGGG - Intergenic
916471656 1:165129549-165129571 GGTTGTCAGGGGATATGGGAGGG - Intergenic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916650096 1:166827102-166827124 TGTTGCCTGGGGATGGGGAATGG + Intergenic
916797713 1:168182057-168182079 TTTTGGCGGAGGGTGGGGGACGG - Intronic
917002768 1:170378080-170378102 TCTTGCCAGGGGCTGGGGAAAGG - Intergenic
917191234 1:172421789-172421811 TGCTGCCAGGGGATGGGGGAGGG - Intronic
917191300 1:172422177-172422199 TGTTGCCTGGGGTTGGGGGAGGG - Intronic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917500523 1:175580921-175580943 AGTTGTCAGGGGGTGGGGGATGG + Intronic
917887285 1:179398858-179398880 TTGTGGCAGGGGTTGGGGGGAGG + Intronic
918340906 1:183567368-183567390 TCATGTGAGGGGATGGGGGCTGG - Intronic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918810682 1:189115974-189115996 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
918974453 1:191463962-191463984 TATTGTCGGGGGAGGGTGGAAGG + Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919570388 1:199241985-199242007 TTTTTTAAGGTGATGGGGTAGGG - Intergenic
919584217 1:199416147-199416169 TCTTGTTGGGGGATGGGGGGAGG - Intergenic
919693394 1:200547652-200547674 GTTTGCCAGGGGTTGGGGGTAGG + Intergenic
919795477 1:201319082-201319104 TTTTTTCATGGGGTGGAGGAGGG - Intronic
919887038 1:201942162-201942184 TGTTAGCAGGGGATTGGGGAGGG - Intronic
920002539 1:202809728-202809750 TTTTGGCGGGAGACGGGGGACGG + Intergenic
920060647 1:203224926-203224948 TGTGGTCAGGGGAAAGGGGAGGG - Intronic
920146748 1:203867845-203867867 GTTTTGCTGGGGATGGGGGAAGG + Intronic
920412427 1:205772900-205772922 TTTTCTCAGGGAAGGGGTGATGG + Intronic
920837021 1:209520462-209520484 TTTGGTCAGGGGATGGGAGTTGG + Intergenic
920945408 1:210524078-210524100 GGTTGCCAGGGGGTGGGGGAAGG + Intronic
921004709 1:211081810-211081832 GCCTGTCATGGGATGGGGGACGG + Intronic
921086153 1:211795026-211795048 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
921107714 1:211999437-211999459 AGTTGTCAGGGGTTGGGGAAAGG + Intronic
921124246 1:212162748-212162770 TTTTGTCTGTGGGTGGTGGATGG - Intergenic
921289335 1:213641810-213641832 TTTTTGCAGGGGGTGGGGGTGGG - Intergenic
921393349 1:214639832-214639854 TTTTGCCAGGGGGCGGGGGGAGG + Intronic
921501457 1:215909271-215909293 GTTTGCCAGGGGTTGGGGGAGGG + Intronic
921556024 1:216600168-216600190 TTTTGGCCGGGGGTTGGGGAAGG + Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921925682 1:220708383-220708405 TCTTCTCAGAGGATGGGGGATGG - Intergenic
921957015 1:220995546-220995568 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
922064046 1:222118763-222118785 ATTTATCAGGGGGTGGGGGGAGG - Intergenic
922110965 1:222554827-222554849 TTTTATGAGGGGAGGTGGGAAGG + Intergenic
922290362 1:224204629-224204651 AGTTGCCAGGGGCTGGGGGAGGG - Intergenic
922360168 1:224813959-224813981 TGTTGGTAGGGGTTGGGGGAGGG - Intergenic
923094428 1:230763408-230763430 TGTTGCCAGGGGCTGGGGGAAGG - Intronic
923255051 1:232214655-232214677 TTGTGTCAGGGGATGGGACGGGG + Intergenic
923366566 1:233267527-233267549 GGTTGCCAGGGGATGGGGGGTGG - Intronic
924747135 1:246846747-246846769 TTTTTTGGGGGGATGGGGGTGGG + Intronic
924763904 1:247013636-247013658 CTTTGTCAGGAGCTGGGGGTAGG - Intergenic
1063035901 10:2286360-2286382 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063331874 10:5167629-5167651 TGTTGTGAGGGGAGTGGGGAGGG + Intergenic
1063723454 10:8609820-8609842 GCCTGTCAGGGGATGGGGGGTGG + Intergenic
1063881724 10:10538577-10538599 TTTGGGCAGGGGATAGGGGTGGG - Intergenic
1064000539 10:11660507-11660529 AGTTGCCAGGGGCTGGGGGAGGG + Intergenic
1064600975 10:16992233-16992255 GTCTGTCATGGGGTGGGGGAAGG + Intronic
1064916034 10:20459820-20459842 TGGTGTGGGGGGATGGGGGAGGG - Intergenic
1065142345 10:22730346-22730368 TTATTTCAGGGGTTTGGGGATGG + Intergenic
1065398567 10:25269468-25269490 TGTGGTCAGGGATTGGGGGAGGG - Intronic
1065401598 10:25308720-25308742 TGGTTTTAGGGGATGGGGGAGGG - Intronic
1065426955 10:25615855-25615877 TGTTGCCTGGGGTTGGGGGAGGG + Intergenic
1065450578 10:25852441-25852463 TTCTATCTGGGGATAGGGGAAGG - Intergenic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1067254084 10:44618119-44618141 GGTTATCAGGGGATGGGTGAAGG + Intergenic
1067399235 10:45955908-45955930 TTTTTCCATGGGTTGGGGGATGG - Intergenic
1067546776 10:47197492-47197514 AGTTGTCAGGGGCTGGGGGCTGG - Intergenic
1067867554 10:49925124-49925146 TTTTTCCATGGGTTGGGGGATGG - Intronic
1067978192 10:51050325-51050347 GGTTGCCAGGGGTTGGGGGAGGG - Intronic
1068091699 10:52440339-52440361 TTCTGAGAGGGGCTGGGGGAAGG - Intergenic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068366720 10:56060505-56060527 GTCTGTCATGGGGTGGGGGAAGG - Intergenic
1068773506 10:60848210-60848232 TGTTCTCATGGGGTGGGGGAGGG + Intergenic
1068787026 10:60987839-60987861 TTTTGTCAGGGGTTAGGGGGTGG - Intronic
1068982488 10:63076240-63076262 TTTTTTGAGGGGGAGGGGGAAGG + Intergenic
1069540099 10:69287586-69287608 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1069880508 10:71589732-71589754 TTAGGGCAGGGGTTGGGGGAAGG - Intronic
1069887705 10:71634381-71634403 TTTTGGCTGGGGTTGGGGCAGGG - Intronic
1070186478 10:74067813-74067835 GGTTATCAGGGGACGGGGGAAGG + Intronic
1070234626 10:74610394-74610416 GTTAGCCAGGGGCTGGGGGAGGG + Intronic
1070275099 10:74998392-74998414 TATAATCAGGGGCTGGGGGAGGG - Intronic
1070815233 10:79318599-79318621 TGGTGTCAGGGGCTGGGGGAGGG - Intergenic
1070832886 10:79431112-79431134 TGTAGGCAGGGGATGAGGGAGGG + Intronic
1071248452 10:83790928-83790950 TTTTGGCGGGGGGTGGGGGGTGG + Intergenic
1071492135 10:86143378-86143400 TTTTTTGGGGGGATGGGGTAGGG - Intronic
1071734066 10:88278688-88278710 TTTTGGAAGAGGTTGGGGGAAGG - Intronic
1071839124 10:89450607-89450629 TGGGGTCAGGGGATGGGGGAGGG + Intronic
1072006749 10:91258118-91258140 GGTTGTCAGGGGATGGGAGGAGG + Intronic
1072070666 10:91913359-91913381 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1072653614 10:97314709-97314731 GGTTGCCAGGGGATGGGAGAAGG - Intergenic
1072754080 10:98006450-98006472 TGTTCTGCGGGGATGGGGGAGGG - Intronic
1072842917 10:98795311-98795333 TGCTGCCAGGGGATGTGGGAGGG - Intronic
1073082451 10:100868629-100868651 TCTAGCCAGGGGATGGGGGCAGG - Intergenic
1073100580 10:101004242-101004264 TTTTGGCAGGGAACGGGGGTTGG + Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1073221593 10:101879073-101879095 TATTCCCGGGGGATGGGGGAAGG - Intronic
1073434537 10:103508226-103508248 TTCTGTCATGGGAGGGGAGAGGG - Intronic
1073498501 10:103915797-103915819 ATTTTTCCGGGGATGGGGGTTGG + Intronic
1073617152 10:105007647-105007669 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074349528 10:112722360-112722382 TTGGGTGGGGGGATGGGGGAGGG + Intronic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1074803375 10:117025203-117025225 TGCTGCCAGGGGATGGGTGAGGG - Intronic
1075380988 10:122018548-122018570 TGTTGTCAGGGGCTGGGGGAAGG - Intronic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075535358 10:123266990-123267012 GGTTGTCAGGGGCTGGGGGGAGG - Intergenic
1075773107 10:124957565-124957587 AGTTGTCAGGGGCTGGAGGAAGG - Intronic
1075956003 10:126523739-126523761 GGTTGTTAGGGGCTGGGGGAAGG - Intronic
1076113870 10:127881668-127881690 ATTGGTCAAGGGATGGGAGAAGG + Intronic
1076178420 10:128386502-128386524 GGTTGTCAGGGGTTGGGGGCGGG + Intergenic
1076258054 10:129044589-129044611 TGTTTTCAGGGGGCGGGGGAGGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076334485 10:129696315-129696337 TTATATCAGGGGGTGGGGAATGG + Intronic
1076485376 10:130812188-130812210 TTTTGTGAGTCGATGTGGGATGG - Intergenic
1076496427 10:130900556-130900578 TTTTTTGTGGGGGTGGGGGACGG - Intergenic
1076564339 10:131387806-131387828 TGGTTTCAGGGGTTGGGGGAGGG - Intergenic
1076992928 11:284947-284969 GTTTGTCAGAGGCTGGGGGAGGG - Intronic
1077377824 11:2213627-2213649 GGGTGTCAGGGGCTGGGGGAGGG - Intergenic
1077413526 11:2414268-2414290 TCTGGGCAGGGGATGGAGGAGGG - Intronic
1077923853 11:6661435-6661457 TTTACTCAGGGGAGGGGGGTGGG - Intergenic
1078487942 11:11741169-11741191 GATTGCCAGGGGCTGGGGGAGGG + Intergenic
1078861539 11:15252206-15252228 TGTTGTCAGGGGATTTGGGGAGG + Intergenic
1078957169 11:16212077-16212099 TCTTGTCACAGGATGGGTGAGGG - Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079551331 11:21702333-21702355 ATTTGTCTGAAGATGGGGGAAGG - Intergenic
1079743531 11:24095714-24095736 GTTTGTCAGGAGTTGGGGAAAGG - Intergenic
1079866525 11:25742254-25742276 GATTGTCAGGGGCTGGAGGAGGG + Intergenic
1079907808 11:26270301-26270323 TCTTGATTGGGGATGGGGGAGGG + Intergenic
1080009851 11:27447035-27447057 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1080073161 11:28114142-28114164 GGTTGTCAGGGGCTGGGGGAAGG - Intronic
1080128452 11:28765851-28765873 TGCTGCTAGGGGATGGGGGAAGG - Intergenic
1080323139 11:31038069-31038091 TGTTGTTGGGGGAGGGGGGAGGG + Intronic
1080906541 11:36551748-36551770 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1080988042 11:37494536-37494558 GGTTGCCAGGAGATGGGGGAAGG + Intergenic
1081005674 11:37734618-37734640 GTTAGTCAAGGGCTGGGGGAAGG - Intergenic
1081247981 11:40792987-40793009 TGGGGTCGGGGGATGGGGGAAGG + Intronic
1081364402 11:42216688-42216710 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1081493390 11:43583521-43583543 TATTGTGAAGGGAAGGGGGAAGG - Intronic
1081546549 11:44075915-44075937 TTTTATCAGGAGATGGGGATGGG + Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1082020396 11:47528097-47528119 TTTTGGGAGGGGTGGGGGGATGG - Intronic
1082297360 11:50458623-50458645 TAGGGTCAGGGGAGGGGGGAGGG - Intergenic
1082311620 11:50656633-50656655 TGTGGTGGGGGGATGGGGGAGGG - Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082593409 11:55043873-55043895 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1082837898 11:57664971-57664993 TTTTTTCTGGTGCTGGGGGATGG - Intergenic
1083160619 11:60852093-60852115 TTTTACCAGATGATGGGGGAGGG - Exonic
1083369710 11:62168561-62168583 GATTGCCAGGGGACGGGGGAGGG - Intergenic
1083513162 11:63230791-63230813 TGGGGTTAGGGGATGGGGGAGGG - Intronic
1083804523 11:65066120-65066142 TTCTGTGAGGGGTCGGGGGAGGG + Intergenic
1084235781 11:67787195-67787217 TTTGGTTGGGGGATGGCGGAGGG + Intergenic
1084570579 11:69957198-69957220 GTTTGTCAGAGGCAGGGGGAGGG - Intergenic
1084990742 11:72922954-72922976 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1085342084 11:75738759-75738781 TTTTTTTGGGGGGTGGGGGATGG - Intergenic
1085441705 11:76569989-76570011 GTTTGCCAGGGGTTTGGGGAAGG - Intergenic
1085478663 11:76804451-76804473 GTTTGTCTGGGGACTGGGGAGGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085782311 11:79420677-79420699 TTTTTTTGGGGGGTGGGGGATGG + Intronic
1085840019 11:80001147-80001169 TATGGTGAGGGGAGGGGGGAGGG - Intergenic
1086261635 11:84947086-84947108 CATTGCCAGGGGATGGGTGAGGG + Intronic
1086333555 11:85777636-85777658 TTTTGGCAGGGGGTGTGGGTTGG - Intronic
1086665634 11:89478185-89478207 TTTTGTCAGGGGACAGGGGCAGG - Intronic
1086698333 11:89870199-89870221 TGCTGTCAAGGAATGGGGGAGGG + Exonic
1086707830 11:89974289-89974311 TGCTGTCAAGGAATGGGGGAGGG - Exonic
1086832474 11:91582933-91582955 GTCTGTCTGGGGGTGGGGGATGG + Intergenic
1086838341 11:91653610-91653632 TATTGCTAGGGCATGGGGGAGGG + Intergenic
1086962678 11:92995734-92995756 GGTTGTCAGGGACTGGGGGAAGG + Intergenic
1087087248 11:94232280-94232302 TTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1087117106 11:94537263-94537285 TTTGGTCTTGGGCTGGGGGAGGG - Intergenic
1087143603 11:94790419-94790441 ATCAGTCAGGGCATGGGGGATGG + Intronic
1087596801 11:100264380-100264402 GTCTGTCAGGGGATGAGGGGAGG - Intronic
1087687389 11:101280626-101280648 TGGGGTCGGGGGATGGGGGACGG - Intergenic
1087982102 11:104628321-104628343 TAGTGTCGGGGGAGGGGGGAGGG - Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088139226 11:106595558-106595580 TTTTGTAGAGGGGTGGGGGATGG + Intergenic
1088531365 11:110813527-110813549 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1088944154 11:114492009-114492031 TGTGGTCGGGGGAGGGGGGACGG + Intergenic
1088948465 11:114539283-114539305 TGTGGTCTGGGGAGGGGGGAGGG + Intronic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089579638 11:119473425-119473447 TTTTGGCAGGGGTGGGGGGTCGG - Intergenic
1089618440 11:119708598-119708620 GGTTGTCAGGGGCCGGGGGAGGG + Intronic
1090089339 11:123680866-123680888 GTTTGCCAGGGGCTGGGGGATGG - Intergenic
1090883511 11:130855711-130855733 GCCTGTCAGGGGCTGGGGGAGGG - Intergenic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1091334115 11:134753877-134753899 TCCTGTCTGGGGTTGGGGGAGGG + Intergenic
1092115818 12:6003675-6003697 TGTTGCCAGGGGCTGGAGGAAGG + Intronic
1092323520 12:7505105-7505127 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1092504601 12:9083240-9083262 TGGGGTGAGGGGATGGGGGAGGG + Intronic
1092546325 12:9454776-9454798 GATTGTCAGGGGCTGGGGGAAGG + Intergenic
1092632730 12:10400516-10400538 GGTTGTCAGGGGCTGGGAGAGGG + Intronic
1092981179 12:13795932-13795954 TGGGGTGAGGGGATGGGGGAGGG + Intronic
1093059878 12:14590597-14590619 TTTTGGCAGGGGTTAGGTGAGGG + Intergenic
1093420147 12:18965421-18965443 TGCTGTCAGGAGATGGGGGAGGG + Intergenic
1093446677 12:19267657-19267679 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1094060409 12:26309246-26309268 TATTGTCAGGGGCGGGGGGATGG + Intergenic
1094273194 12:28639993-28640015 TGTGGTGTGGGGATGGGGGAGGG + Intergenic
1094330117 12:29282114-29282136 TTTGGTTAGGATATGGGGGAGGG - Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1094419665 12:30257415-30257437 CACTGTCAGGGGATGGGGGAGGG - Intergenic
1094506617 12:31067298-31067320 GATTGTCAGGGGCTGGGGGAAGG - Intergenic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1095090194 12:38097313-38097335 TGGGGTCAGGGGAGGGGGGAAGG + Intergenic
1095151935 12:38805511-38805533 TGGGGTCGGGGGATGGGGGAGGG + Intronic
1095208849 12:39469794-39469816 TGTGATCAGGGGAGGGGGGAGGG - Intergenic
1095236392 12:39801096-39801118 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1095277121 12:40299565-40299587 GGTTGTCAGGGGTTAGGGGAGGG + Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095363723 12:41375907-41375929 TGTTGCCAGGGGATGGGGCTTGG - Intronic
1096337386 12:50766647-50766669 TTTTATGGGGGGAGGGGGGAGGG - Intronic
1097617560 12:61901418-61901440 ATTGGTCGGGGGAGGGGGGAGGG - Intronic
1097958857 12:65513174-65513196 TTTTGTAAGGGGATGGGAAGGGG - Intergenic
1098349861 12:69547190-69547212 TTTTGTCAGGGGATAGGGGGAGG + Intronic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1098462519 12:70747988-70748010 TATTTTCAGGGTGTGGGGGAAGG + Intronic
1098546407 12:71716739-71716761 TTTTTTCGTGGGATGGGGGGCGG + Intergenic
1098667596 12:73183276-73183298 TGTTGTGAGGGGATGGGGTCGGG - Intergenic
1098834020 12:75398794-75398816 TTTTCTCTGGGGATGGAGAAAGG - Intronic
1099168763 12:79338811-79338833 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1099224312 12:79950781-79950803 TTTTGTAGGGGGGTGGGGGCAGG + Intergenic
1099433605 12:82618482-82618504 TGCTGCCAGGGGATGGAGGATGG - Intergenic
1099587252 12:84533902-84533924 TTTTGGCGGGGGATGGGGTGAGG - Intergenic
1099692018 12:85966895-85966917 TGGGGTCAGGGGAGGGGGGAGGG + Exonic
1099826241 12:87780612-87780634 TGCTGCCAGGGTATGGGGGAGGG + Intergenic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1099953752 12:89332391-89332413 TTTTGTAGGGGGAGGGGGCAGGG - Intergenic
1100039468 12:90296287-90296309 TTTTGCCTGGGGATGGGGGATGG - Intergenic
1100282396 12:93130402-93130424 TTTTGGCAGTGGATGGGGTCTGG - Intergenic
1100357581 12:93845947-93845969 GGTTGCCAGGGGGTGGGGGAGGG - Intronic
1100626507 12:96338969-96338991 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1100626544 12:96339351-96339373 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1100909307 12:99339388-99339410 CATTGTCAGGGAATGGGGCAGGG + Intronic
1101004272 12:100386469-100386491 GGTTGTCAGGTGCTGGGGGAGGG - Intronic
1101026257 12:100609489-100609511 TGCTGCCAGGGGATGGGGGAGGG + Intronic
1101299478 12:103463740-103463762 GTCTGTCAGGGGCTGGGGGCAGG - Intronic
1101756910 12:107628136-107628158 TTTTTTTGGGGGGTGGGGGAGGG + Intronic
1102227191 12:111237223-111237245 AGCTGTCAGGTGATGGGGGATGG - Intronic
1102262906 12:111455837-111455859 TTTTGTCATGGGATCAGTGAAGG - Intronic
1102305527 12:111801806-111801828 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1103349840 12:120276544-120276566 TTTTCTCAGGTGAAGGGGGCTGG + Intergenic
1103364830 12:120374301-120374323 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1103748199 12:123140568-123140590 TTCTGTTAGGGGGTGGGGCAGGG - Intronic
1103810271 12:123607903-123607925 AGTGGTCAGGGGCTGGGGGATGG + Intronic
1104021998 12:124998589-124998611 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1105276510 13:18933408-18933430 TTTAGTCAGTGGACTGGGGAAGG + Intergenic
1105282254 13:18973289-18973311 GGTTGTCAGGGGCTGGGGGAAGG + Intergenic
1105356973 13:19667527-19667549 GGTTGTCAGGGGCTGGGGGAGGG - Intronic
1105544363 13:21340857-21340879 AGTTGTCAGGGGAGGGGGGTTGG - Intergenic
1105785028 13:23740054-23740076 TTTTGTCAGGGCATCTGGCAAGG + Intronic
1105970577 13:25426064-25426086 GGTTGCCAGGGGTTGGGGGAGGG + Intronic
1106201493 13:27541347-27541369 TTATGGGAGGGGTTGGGGGAAGG - Intergenic
1106356717 13:28990258-28990280 CTATGTGAGAGGATGGGGGATGG + Intronic
1106380991 13:29238935-29238957 GATTGTCAGGGGATGGAGGGTGG + Intronic
1106561621 13:30851630-30851652 TTTTTTGGGGGGAAGGGGGAGGG - Intergenic
1106968831 13:35110197-35110219 TTCTTTCGGGGGAGGGGGGAGGG - Intronic
1107218157 13:37947067-37947089 TGAGGTCAGGGGAGGGGGGAGGG - Intergenic
1107612212 13:42126747-42126769 TTATGACAAGAGATGGGGGAAGG - Intronic
1108501301 13:51072191-51072213 TTTTGACTGGGGATGGGGGTGGG - Intergenic
1108510812 13:51154001-51154023 GGTTGTCAGGGGCTGGGGGTAGG - Intergenic
1108536262 13:51383083-51383105 TTTTGCGGGGGGGTGGGGGAGGG - Intronic
1108689612 13:52848999-52849021 TGTTGGCAGGGGCTGGGGGAAGG - Intergenic
1108744677 13:53379998-53380020 GATTGCCAGGGGATGGGGGAAGG - Intergenic
1109298290 13:60562313-60562335 TTTTGCCGGGGGTGGGGGGAAGG - Intronic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109422962 13:62137684-62137706 TATAGGCATGGGATGGGGGAGGG - Intergenic
1109448226 13:62473595-62473617 TTTTGTTAAGGGGTGGGTGAGGG + Intergenic
1109451086 13:62515058-62515080 TTTTTTTAGGGGATGGGAAAGGG + Intergenic
1110812763 13:79828770-79828792 GCCTGTCATGGGATGGGGGAGGG + Intergenic
1110939585 13:81332161-81332183 GGTTGTCAGGGGTTGGGGAAGGG + Intergenic
1110979435 13:81876678-81876700 CCTTGTCAGGGGATGAGGAATGG + Intergenic
1111085935 13:83374724-83374746 TGCTGCCAGGGGATGGAGGAGGG + Intergenic
1111696786 13:91634340-91634362 TTTTATGGGGGAATGGGGGATGG + Intronic
1111885425 13:94014699-94014721 GGTTGTCAGGGGATGGGGCAAGG - Intronic
1111927085 13:94475511-94475533 GGTTACCAGGGGATGGGGGAGGG + Intronic
1111959502 13:94794446-94794468 GGTTGCCAGGGGTTGGGGGAAGG + Intergenic
1112046877 13:95606396-95606418 TGTTGTCTGGGGATAGGGAAGGG - Intronic
1112301590 13:98235733-98235755 GGTTGGCAGGGGCTGGGGGACGG - Intronic
1112560165 13:100505855-100505877 TTTTTGGGGGGGATGGGGGAGGG - Intronic
1112568664 13:100573302-100573324 ATATTTCATGGGATGGGGGAAGG - Intronic
1112702250 13:102023605-102023627 TGTTGTCAGGGGCTGGGGAAAGG - Intronic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1112901622 13:104363909-104363931 TACTGCCAGGGGTTGGGGGAAGG + Intergenic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113072381 13:106434278-106434300 TTTTGTTGGGTGGTGGGGGATGG - Intergenic
1113244367 13:108377752-108377774 TGCTGTCTGGGGTTGGGGGATGG + Intergenic
1113387118 13:109859075-109859097 GTTTGCCATGGGCTGGGGGAGGG + Intergenic
1113475493 13:110577813-110577835 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1113745227 13:112739955-112739977 GGTTGGCAGGGGCTGGGGGAGGG + Intronic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114096713 14:19343664-19343686 TTTTTTGGGGGGGTGGGGGATGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114126782 14:19737211-19737233 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1114761711 14:25323028-25323050 TGTTGCCAGGAGATGGGGGAAGG + Intergenic
1115334836 14:32234736-32234758 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1115368524 14:32585800-32585822 TTTTGTTAGGGAAGGGAGGATGG + Intronic
1115435281 14:33364997-33365019 TTTTTTTGGGGGAGGGGGGAGGG + Intronic
1115479053 14:33844083-33844105 TTCTGATGGGGGATGGGGGAAGG - Intergenic
1116029102 14:39549546-39549568 TTTTGGTGGGGGATGGAGGATGG + Intergenic
1116056434 14:39870067-39870089 GTTTGCCAGGGGGTGGGGCAAGG - Intergenic
1116489949 14:45493378-45493400 TTCTGTCAGGGGATGAGAAAAGG + Intergenic
1116498927 14:45596811-45596833 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1116583574 14:46674239-46674261 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
1116634993 14:47383196-47383218 GCCTGTCAGGGGATGGGGGAGGG + Intronic
1116839884 14:49809425-49809447 GGTTGTCGGGGGTTGGGGGAAGG + Intronic
1116857413 14:49965221-49965243 GTTTGGCAGGAGCTGGGGGAAGG + Intergenic
1117246583 14:53892317-53892339 TTTTGGCAGGGGTGGGGGGGTGG - Intergenic
1117312692 14:54543973-54543995 GGTTGTCAGGGGCTGGGGGAGGG - Intergenic
1117472267 14:56057803-56057825 TTGGGGCAGGGGATGGGGGTTGG - Intergenic
1117928013 14:60805571-60805593 GTTTGTCAGGGGTTGGGGTAGGG - Intronic
1117929319 14:60823311-60823333 TTTTGAGTGGGGATTGGGGAGGG + Intronic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1118103217 14:62628993-62629015 TTTGGTGGGGGGAGGGGGGAGGG - Intergenic
1118265086 14:64287208-64287230 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1118542580 14:66844885-66844907 GTTTACCAGGGGTTGGGGGAGGG - Intronic
1118807079 14:69247315-69247337 TTCTGTCAGGTCATAGGGGATGG - Intergenic
1118905816 14:70022475-70022497 TTTAGTCAGGGGATCTGGGGTGG - Intronic
1118937900 14:70304895-70304917 TACAGTCAGGGGATGGGGGAAGG - Intergenic
1119780598 14:77274469-77274491 GTTGGACAGAGGATGGGGGAGGG - Intergenic
1120189075 14:81423624-81423646 TTTTGTTGGGGGAAGAGGGAGGG - Intronic
1120676722 14:87429140-87429162 TGTTGTGGGGGGAAGGGGGAGGG + Intergenic
1120764899 14:88320023-88320045 TCTAGCCAGGGGATGGAGGAGGG - Intronic
1121023237 14:90594910-90594932 TTTGGTGAGGGGTTGGTGGATGG + Intronic
1121084185 14:91132823-91132845 AGTTGCCAGGGGCTGGGGGAAGG - Intronic
1121194349 14:92056584-92056606 AGTTGTCAGGGGCTGGGGAAGGG + Exonic
1121205137 14:92158383-92158405 TTTTGTCTGGTAATGGGAGATGG + Intronic
1121587284 14:95070883-95070905 TAATGTCCGGGGAAGGGGGAGGG + Intergenic
1123500246 15:20875537-20875559 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123557492 15:21449231-21449253 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123593719 15:21886493-21886515 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123916329 15:25032287-25032309 TTTTGGCAGGGGATGTGGGGAGG - Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1124891080 15:33733575-33733597 TGGTGTCAGGGGTTGGGGGAGGG + Intronic
1124984197 15:34589961-34589983 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1125089147 15:35770511-35770533 TTATGTCAGGTGATCGGGAAAGG + Intergenic
1125176125 15:36823801-36823823 TTTTTTTAGGGGATGGGGGTTGG + Intergenic
1125183553 15:36905256-36905278 TTTTGTCGGGGGGTGGGGAGGGG + Intronic
1125520174 15:40344052-40344074 CCTTGTCTGGGAATGGGGGAGGG - Intergenic
1125566211 15:40680378-40680400 TGCTGCCAGGGGATGGGGGAGGG + Intergenic
1125957644 15:43801224-43801246 TTTTGTCTGGGGACCGGGGAGGG - Intronic
1126575219 15:50189751-50189773 TTTTCTCAGAGGCTGTGGGAAGG - Intronic
1127075575 15:55322168-55322190 TTTTTGCGGGGGATGGGGGAAGG - Intronic
1127348026 15:58120761-58120783 TTTTGTGGGGGGAGGGGGGAGGG - Intronic
1127598957 15:60515746-60515768 TTTTTTCGGGGGAGGGGGCAGGG + Intronic
1127756877 15:62101167-62101189 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1127821161 15:62657336-62657358 TTTTATCTGGGGATGGGGGTTGG + Intronic
1128144795 15:65327086-65327108 TTGTGTCAGGTCCTGGGGGAGGG - Intergenic
1128235173 15:66062071-66062093 TTTGGTCAGGTGATCTGGGAAGG + Intronic
1128259550 15:66223318-66223340 GCTTGCCAGGGGCTGGGGGAGGG + Intronic
1128460253 15:67861592-67861614 TTTTCACAGGGGATAGGGGCAGG - Intergenic
1128462906 15:67884719-67884741 TTTGTTCCAGGGATGGGGGAGGG - Intergenic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1128769920 15:70274318-70274340 TTTTGTGAGGTGAGGTGGGAGGG + Intergenic
1129197696 15:73980653-73980675 TAATCGCAGGGGATGGGGGAAGG + Exonic
1129204866 15:74031145-74031167 GGTTGCCAGGAGATGGGGGAGGG - Intronic
1129222085 15:74136818-74136840 TTTTGTCAGGGGACAGAGGGAGG + Intronic
1129265887 15:74392851-74392873 GTTTGCCAGTGGATGGGAGAGGG - Intergenic
1129500985 15:76037735-76037757 TGTTGCCTGGGGTTGGGGGACGG - Intronic
1129508982 15:76106148-76106170 TCTTTGCAGGGGCTGGGGGATGG - Intronic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1129787763 15:78320755-78320777 GTATGTCAGGGGGTGGGGGCGGG + Intergenic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1130326297 15:82883035-82883057 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1130691980 15:86089625-86089647 ATTGGTCAGGGGAAGGGTGAGGG - Intergenic
1130890237 15:88127485-88127507 TTTTCTCTGGGGTTGGGGCAGGG - Intronic
1131193881 15:90339544-90339566 GTTTGCCAGGGGCTGGGAGAAGG + Intergenic
1131526584 15:93157751-93157773 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1131605411 15:93898751-93898773 TTTTATGAGGGGATGTAGGAGGG - Intergenic
1131726148 15:95227447-95227469 TCCTGTGAGAGGATGGGGGAAGG + Intergenic
1131814772 15:96211173-96211195 TATGGTCACAGGATGGGGGACGG - Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1202965842 15_KI270727v1_random:176404-176426 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1132968972 16:2675768-2675790 TTTTTTCGGGGGGTGGGGGACGG - Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133228020 16:4351971-4351993 GGTTGACAGGGGCTGGGGGAGGG - Intronic
1133232807 16:4374391-4374413 TTTGGGCAGGGGGTGGGGGCAGG + Intronic
1133347360 16:5079834-5079856 TTTGGTTGGGGGATGGCGGAGGG + Intronic
1133477203 16:6134986-6135008 TGGGGTCAGGGGAGGGGGGACGG - Intronic
1133521159 16:6558770-6558792 TTAAGTCAGGGGGTGGGGGTGGG - Intronic
1133609441 16:7419201-7419223 TCTTGGCTGGGGGTGGGGGACGG - Intronic
1133640255 16:7709743-7709765 TTTTGGGAGGGGGTGGGGGGAGG + Intronic
1134004971 16:10812727-10812749 ATTTACCAGGGGCTGGGGGAAGG + Intronic
1134389451 16:13805898-13805920 TTTCTACAGGGGATGGGGGTCGG - Intergenic
1134484964 16:14650500-14650522 GTTTGCCAGGGGCTGGGGGTTGG - Intronic
1134501514 16:14772505-14772527 TTGTGTGAGAGGATGAGGGAGGG - Intronic
1134562405 16:15221957-15221979 GGTTGCCAGGGGTTGGGGGAGGG + Intergenic
1134579048 16:15356374-15356396 TTGTGTGAGAGGATGAGGGAGGG + Intergenic
1134723538 16:16401176-16401198 TTGTGTGAGAGGATGAGGGAGGG - Intergenic
1134909950 16:18016396-18016418 TTTTGACAGGAGTTGGGGAAGGG + Intergenic
1134922947 16:18133584-18133606 GGTTGCCAGGGGTTGGGGGAGGG + Intergenic
1134943891 16:18310694-18310716 TTGTGTGAGAGGATGAGGGAGGG + Intergenic
1135055656 16:19230036-19230058 GATTATCAGGGGCTGGGGGAAGG + Intronic
1135464911 16:22676805-22676827 TTTAATCATGGGGTGGGGGAGGG + Intergenic
1135676331 16:24418015-24418037 TTTTTTGGGGGGTTGGGGGATGG - Intergenic
1136154955 16:28376313-28376335 TTGTGTGAGAGGATGAGGGAGGG + Intergenic
1136208136 16:28738945-28738967 TTGTGTGAGAGGATGAGGGAGGG - Intergenic
1136264219 16:29105578-29105600 TTGTGTGAGAGGATGAGGGAGGG - Intergenic
1136507409 16:30713727-30713749 GTTTGTCAGGGTATTGGGAATGG + Intronic
1137245491 16:46700199-46700221 GGTTGTCAGGGGATGTGGGGAGG - Intergenic
1137485488 16:48887180-48887202 TTTACTCAGGGGTTGGGGGTGGG - Intergenic
1137495704 16:48967550-48967572 TTTAGTGAGGGGGTGGGGAAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137666799 16:50254808-50254830 TTTTGGCAGGGGGTGGGGGTGGG - Intronic
1137678645 16:50318766-50318788 TTTTGTCAGGGGTGGGTGGGAGG + Intronic
1137963156 16:52905808-52905830 GGTTGTCAGGGGCTGGGGGTAGG + Intergenic
1138618393 16:58191196-58191218 TGTTGCCAGGAAATGGGGGAGGG + Intronic
1138732749 16:59213752-59213774 TTTTTGCAGGGGATGAGAGAAGG + Intergenic
1138779640 16:59767438-59767460 GTCAGTCAGGGGACGGGGGAAGG - Intergenic
1139258902 16:65573169-65573191 TTTTCACAGTGGATGGGGGATGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1139835994 16:69838990-69839012 TTTTTTGGGGGGGTGGGGGAAGG + Intronic
1139883664 16:70193862-70193884 TTTTTTTGGGGGATGGGGGTGGG - Intergenic
1139939743 16:70596625-70596647 TTTTGGCAGGGTGTGGGGGACGG - Intronic
1140368846 16:74401651-74401673 TTTTTTTGGGGGATGGGGGTGGG + Intergenic
1140627438 16:76811182-76811204 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1140999996 16:80299071-80299093 TTTGGTGGGGGGATGGGGGAGGG + Intergenic
1141480357 16:84302188-84302210 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1141536863 16:84687642-84687664 GTTTGTCATGGGGTGGGGAAAGG + Intergenic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142198643 16:88750694-88750716 GTTTGTCAGGAGATGAGGGGTGG + Intronic
1142332838 16:89466328-89466350 AGTTGTCAGGGAAAGGGGGAAGG + Intronic
1142509379 17:384928-384950 GTTTTTCAGGAGATGGGAGATGG + Intronic
1142746338 17:1960713-1960735 GTTTGCCAGGGGCTGGGGGAGGG - Intronic
1142948252 17:3454440-3454462 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1143582989 17:7837032-7837054 TTTTGTGAGGGGGAGGGGCACGG + Intergenic
1143765489 17:9135028-9135050 TTTGGTCTGGGTATGGGGGTTGG - Intronic
1143874602 17:9982077-9982099 TGTGGTCATGGGATGGTGGAAGG - Intronic
1144113606 17:12063964-12063986 TTCTGTCAGGGGGCGGGGGGCGG + Intronic
1144465191 17:15491322-15491344 TTTTAACTGGGGATGGGGGCAGG + Intronic
1144517650 17:15929847-15929869 GGTTGCCAGGGGCTGGGGGAAGG + Intergenic
1144938787 17:18921988-18922010 GGTTGCCAGGGGCTGGGGGATGG - Intronic
1145127544 17:20314682-20314704 TTTTGGGGGGGGAGGGGGGAAGG - Exonic
1145855117 17:28148235-28148257 TTTTGTGGGGGGGTGGGGGCAGG - Intronic
1146180543 17:30695445-30695467 GATTGCCAGGGGATGGGGGATGG - Intergenic
1146225989 17:31066654-31066676 TTTTTTTTGGGGGTGGGGGATGG - Intergenic
1146717949 17:35101879-35101901 GGTTGTCAGGGGCTGGGGAAGGG + Intronic
1146820522 17:35980774-35980796 TTTAGTCATAGGCTGGGGGATGG + Intronic
1146984791 17:37205250-37205272 TTTTATGAGGGGATTGGAGAGGG + Intronic
1147032037 17:37646326-37646348 TTTTGTCAGGGTGTGTTGGAGGG + Intergenic
1147153407 17:38531339-38531361 TTTTGGCGGGGGAGGGGGGCTGG - Exonic
1147653090 17:42072936-42072958 TGCTGACAGGGGGTGGGGGAAGG - Intergenic
1148216268 17:45835492-45835514 TTTTGTGAGAAGATGGGGGCTGG + Exonic
1148346309 17:46905816-46905838 GTTTGTTGGGGGATGGGGTAAGG + Intergenic
1148384524 17:47224539-47224561 GATTGCCAGGGGCTGGGGGAAGG - Intergenic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148468822 17:47880886-47880908 TTGTGGCAGAGGCTGGGGGAGGG - Intergenic
1148474398 17:47917379-47917401 TTTTTTCAGGGGATGGTGAGGGG + Intronic
1148842038 17:50505163-50505185 GATTGTTAGGGGATGGGGGTCGG + Intergenic
1149061963 17:52433265-52433287 TCTGATGAGGGGATGGGGGAGGG + Intergenic
1149153295 17:53595002-53595024 TGCTTTCAGGGGGTGGGGGAGGG + Intergenic
1149313295 17:55417004-55417026 TTCTGTCATGGCATGGGAGAGGG - Intronic
1149718289 17:58816553-58816575 GGATGGCAGGGGATGGGGGAAGG - Intronic
1149762764 17:59247388-59247410 GGTTGGCAGGGGATGAGGGAAGG - Intronic
1149869390 17:60168529-60168551 TTTTGGGAGGGGGTGGGGAAGGG + Intronic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1150695615 17:67402509-67402531 CTTTGTCAGGAAATGGCGGAGGG - Intronic
1150887008 17:69098789-69098811 TATTTCCAGGGGATGGGGGAGGG + Intronic
1151369942 17:73641581-73641603 TTTTTTTTGGGGATGGGGGGTGG - Intronic
1151426241 17:74032763-74032785 TGTTGTTAGAGGCTGGGGGAGGG - Intergenic
1151778047 17:76221995-76222017 GATTGCCAGGGGATGGGGGCAGG + Intronic
1151877443 17:76874808-76874830 TTTTGCCTGGGTATGGGGGTGGG + Intronic
1152098214 17:78285241-78285263 GGTTGTCAGGGGCTGGGGGAGGG + Intergenic
1152238110 17:79148897-79148919 GTTTGTAAGGTCATGGGGGATGG + Intronic
1152933362 17:83121795-83121817 TTTTGTCTGAGGAGAGGGGATGG + Intergenic
1153503838 18:5774786-5774808 GTTGGTCAGGGGTTGTGGGAGGG + Intergenic
1153606368 18:6837452-6837474 GTTTGACTGGGGATGGGGTAGGG + Intronic
1154085855 18:11305117-11305139 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
1154520902 18:15229250-15229272 TGTGGTCGGGGGAGGGGGGAGGG - Intergenic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155087039 18:22468713-22468735 TGCTGCCAGGGGATGGGGGCAGG + Intergenic
1155215488 18:23639887-23639909 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1155281941 18:24249548-24249570 TGTTGCCAGGGGATAGGGGAGGG - Intronic
1155459415 18:26060374-26060396 TGTTGCCAGGGGATGGGGAGAGG + Intronic
1155807968 18:30196131-30196153 GGTTGCCAGGGGATGGGAGAGGG - Intergenic
1156168742 18:34456191-34456213 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1156423922 18:36987335-36987357 TGGGGTCGGGGGATGGGGGAGGG + Intronic
1156438715 18:37162244-37162266 TTTTTTGTGGGGGTGGGGGAAGG + Intronic
1156474707 18:37398186-37398208 TATTGAAAGGGAATGGGGGAAGG - Intronic
1157066764 18:44359114-44359136 GCTTGTCAGGGGGTGGGGGGAGG - Intergenic
1157249789 18:46084812-46084834 TTCTGTCAGGGGTGGGAGGAAGG - Intronic
1157468834 18:47971901-47971923 GCCTGTCAGGGGATGGGGTAGGG - Intergenic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1157994931 18:52543741-52543763 TTTTGTCCTGGTATGGGAGAAGG - Intronic
1158368663 18:56771558-56771580 TTTTGGGGGGGGGTGGGGGAGGG - Intronic
1158763967 18:60425415-60425437 TTTTATCAAGGCATGAGGGAGGG - Intergenic
1158793644 18:60814028-60814050 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1158974454 18:62698439-62698461 GTTTGTCAGGGGCTGGGAGTTGG - Intergenic
1159008549 18:63036737-63036759 TTTTTTCGGCGGAGGGGGGATGG - Intergenic
1159068434 18:63594831-63594853 TTTTTTGGGGGGGTGGGGGATGG - Intronic
1159481114 18:68992601-68992623 TTTGGGCGGGGGATGGGGGCGGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159828213 18:73241272-73241294 TTTTGTGTGGGGGTGGGGGCGGG + Intronic
1160176062 18:76595339-76595361 GGTAGTCAGGGGATGGGGGTAGG + Intergenic
1160243904 18:77142061-77142083 TTTGGTGGTGGGATGGGGGAGGG + Intergenic
1160383361 18:78477881-78477903 GCTGCTCAGGGGATGGGGGACGG - Intergenic
1160710588 19:549287-549309 TCCTGTCAGGGGCTGGGGGGCGG + Intronic
1160791573 19:925955-925977 ATTTGTCTGGGGGTGGGGGAGGG + Intronic
1161113460 19:2483144-2483166 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1161160489 19:2758962-2758984 GGTTGTCAGGGGATAGGAGAGGG + Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161991995 19:7689446-7689468 TTGGGTCAGGGGATGGGGCGGGG + Intronic
1162364977 19:10243036-10243058 TTTGGACAGTTGATGGGGGAGGG + Intergenic
1162612160 19:11765246-11765268 TTTGGTCAGGTGTTGGTGGAAGG + Intergenic
1162937675 19:13989627-13989649 TTTTGTCAGGTATCGGGGGAGGG + Intronic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163166804 19:15503971-15503993 TGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1163280553 19:16314134-16314156 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
1163304677 19:16470503-16470525 TGTAGTCAGGGGGTGGGGGGCGG - Intronic
1163572211 19:18089176-18089198 GGTTGTCAGGGGCTGGGGGGAGG + Intronic
1163807771 19:19410326-19410348 TTGGGGCAGGGGGTGGGGGATGG + Intronic
1164256056 19:23529257-23529279 TTTTTTTGGGGGGTGGGGGAAGG + Intronic
1164262351 19:23579122-23579144 TTTTGGCAGTGGGAGGGGGATGG + Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164349695 19:27320793-27320815 TGGAGTCAGGGGTTGGGGGAGGG + Intergenic
1164872069 19:31654375-31654397 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1164919504 19:32078285-32078307 TATTTTGGGGGGATGGGGGAGGG - Intergenic
1165149835 19:33753904-33753926 GATGGTGAGGGGATGGGGGATGG - Intronic
1165186416 19:34026161-34026183 TTTTGTCAGTGGACTGGGAAAGG + Intergenic
1165586344 19:36919426-36919448 TTTTTCCAGGGACTGGGGGATGG + Intronic
1165717424 19:38055484-38055506 AGTTTGCAGGGGATGGGGGATGG - Intronic
1165722685 19:38090816-38090838 CTTGGTCAGGGGATGGGGCGAGG - Intronic
1166197306 19:41215600-41215622 TTTTGGGGGGGGAGGGGGGATGG + Intergenic
1167052723 19:47089601-47089623 CTTTGTCAGGTGATGGGGCTGGG + Intronic
1167173673 19:47850591-47850613 TTTTGCCAGGGGTTGGGGGTGGG - Intergenic
1167316474 19:48766234-48766256 TTTTTTGGGGGGGTGGGGGAGGG + Intergenic
1167389587 19:49185753-49185775 TTTTTTGGGGGGAGGGGGGATGG + Intronic
1167689795 19:50978325-50978347 AGCTGTCAGGGGATGTGGGATGG - Intronic
1168479951 19:56711456-56711478 GGTTGCCAGGGGATAGGGGAGGG - Intergenic
925619034 2:5772614-5772636 CTTTGTCAGAGGAGGAGGGAAGG + Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
925950529 2:8905655-8905677 TGTGGTGGGGGGATGGGGGAGGG + Intronic
925964181 2:9048048-9048070 TTTTTCCAGGGGCTGCGGGATGG - Intergenic
926004003 2:9357510-9357532 TTTTGGCAGGAGATGAGGTAGGG + Intronic
926259763 2:11248211-11248233 TTTTGGGGGGGGATGGGGGGAGG + Intronic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
926896676 2:17698115-17698137 TTTTGCCAGGGGATGGGAACAGG + Intronic
927411474 2:22831079-22831101 TTTTGGGGGGGGGTGGGGGACGG - Intergenic
927433415 2:23046441-23046463 TGTTGCCAGAGGCTGGGGGAAGG - Intergenic
927491883 2:23526307-23526329 TGTGGTCAGGGCATGCGGGAGGG + Intronic
927495262 2:23547664-23547686 TTTTCTCGGGGGAGGCGGGAGGG - Intronic
927528634 2:23772727-23772749 TTTTTTGGGGGGATGGGGGTGGG + Intronic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
927814970 2:26207210-26207232 TTTTGTTAGGGGAAAGGGGTGGG - Intronic
927910127 2:26891561-26891583 TTTTGAAAGGAGATGGGTGAGGG - Intronic
928443132 2:31310600-31310622 TTTTGGCAGGGGTTGGGGGGTGG + Intergenic
928565798 2:32547370-32547392 AATTGCCAGGGGCTGGGGGAAGG - Intronic
928855725 2:35800495-35800517 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
929063145 2:37943908-37943930 TTTTCTTAGGTGGTGGGGGAGGG - Intronic
929452385 2:42046692-42046714 TTTTTTCTGGGGGTGGGGGTGGG - Intergenic
929525184 2:42694621-42694643 CTCTGCCAGGGGATGGGAGAGGG + Intronic
929559955 2:42950162-42950184 TTTTGTCTGTGGATGCTGGAGGG - Intergenic
929716441 2:44315485-44315507 TTTTGGCGGGGGTAGGGGGAAGG - Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929869894 2:45750289-45750311 TTTTCCCAGGGGCTGGGGGAGGG - Intronic
929871876 2:45766006-45766028 TTTTGCCTGGAGGTGGGGGAGGG - Intronic
930041661 2:47129644-47129666 TGCTGCCAGGGGATGGGGGAGGG + Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930224700 2:48780369-48780391 AGTTGTCAGGGGCTGGGGGAGGG + Intergenic
930570333 2:53077920-53077942 GCTTGTCAGGGGTTGGGGGACGG - Intergenic
930606925 2:53502502-53502524 TGGTGTCGGGGGAGGGGGGAGGG - Intergenic
930867602 2:56137287-56137309 TGTTGTAGGGGGGTGGGGGAGGG - Intergenic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931278428 2:60765066-60765088 TTGTGTGGGGGAATGGGGGAAGG + Intronic
931582885 2:63796497-63796519 CACTGCCAGGGGATGGGGGAGGG - Intronic
931611446 2:64105798-64105820 ATTTGTCAGGGGGCGGGGGCAGG - Intronic
932116087 2:69049213-69049235 TTTTGGCAGGGGATGGGGATGGG - Intronic
932305212 2:70697140-70697162 TTTTGGGAGGGTGTGGGGGACGG - Intronic
932312321 2:70753583-70753605 GTGTGTCAGGGGTTGGGGGGTGG + Intronic
932392743 2:71411616-71411638 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
932397222 2:71456326-71456348 TGTGGCCAGGGGCTGGGGGAGGG - Intronic
932492649 2:72131849-72131871 TTTTAGCTGGGGTTGGGGGACGG - Exonic
932517436 2:72367675-72367697 CACTGCCAGGGGATGGGGGAGGG - Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
932687787 2:73887811-73887833 TGTTGCCAGGGGCTGGGGGAGGG + Intergenic
933019055 2:77167793-77167815 GCCTGTCATGGGATGGGGGAAGG + Intronic
933155935 2:78974542-78974564 GGTTGCCAGGGGATGGGGAAAGG - Intergenic
933647575 2:84825027-84825049 TTTTGTCAAGGGTTTGGTGAAGG + Intronic
933848779 2:86348992-86349014 TTTTGGCAGGGGTTTGGGGTGGG - Intergenic
933887285 2:86730256-86730278 TTTTTTTGGGGGGTGGGGGAGGG + Intronic
933922890 2:87066457-87066479 TTTTTTTGGGGGGTGGGGGAGGG - Intergenic
933992639 2:87644442-87644464 TCCTGCCAGGGGCTGGGGGAGGG - Intergenic
934083383 2:88488602-88488624 TTTTTTCGGTGGAGGGGGGATGG + Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935053371 2:99543704-99543726 TTTTGTTAGGGGGTGGGGGTAGG - Intergenic
935277667 2:101489510-101489532 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
936064959 2:109323973-109323995 GTTTTCCAGGGGCTGGGGGAAGG - Intronic
936280070 2:111131207-111131229 TTTTGGCGGGGGATGGGGGCGGG + Intronic
936301214 2:111306399-111306421 TCCTGCCAGGGGCTGGGGGAGGG + Intergenic
936707356 2:115090438-115090460 TTTTGTCAGGGATTTGGGGAGGG + Intronic
936717602 2:115206667-115206689 TTTTGGCAGGGGATGGGTTGTGG + Intronic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
936973241 2:118194832-118194854 GATTGTCAGGGGCTGGGGGTAGG + Intergenic
937227386 2:120377590-120377612 TTTTCTCAGGGGAGGGTGTAAGG - Intergenic
937283646 2:120736628-120736650 TTTTTTCAGGGGGTGGAGGGTGG + Intronic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937512387 2:122611035-122611057 TTCTGCCAGGGGATGGGGCAGGG - Intergenic
938049370 2:128153524-128153546 TGTTGCCAGAGGATAGGGGAAGG - Intronic
938106288 2:128532630-128532652 TGTTTTCAGGGACTGGGGGATGG + Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938225657 2:129614126-129614148 TGTTGTGAGGGGATTGGGGTGGG + Intergenic
938226097 2:129617750-129617772 AGTTGCCAGGGGCTGGGGGAAGG + Intergenic
938285213 2:130107906-130107928 TTTTTCCATGGGCTGGGGGAGGG - Intronic
938335863 2:130496449-130496471 TTTTTCCATGGGCTGGGGGAAGG - Intronic
938353960 2:130624215-130624237 TTTTTCCATGGGCTGGGGGAAGG + Intronic
938430386 2:131230987-131231009 TTTTTCCATGGGCTGGGGGAGGG + Intronic
938574335 2:132589872-132589894 TTTTATTAAGGGAAGGGGGAAGG + Intronic
938864969 2:135408825-135408847 TGGGGTCGGGGGATGGGGGAGGG + Intronic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939367516 2:141252192-141252214 TTTTTTTAGGGGGTGGGGGGTGG - Intronic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
939708040 2:145479242-145479264 TGCTGCCAGGGGATAGGGGAGGG + Intergenic
939756964 2:146126242-146126264 TTTTGTCATGGGGTGGGGAGAGG - Intergenic
939949690 2:148455289-148455311 TTTTGTCCAGGGTTTGGGGATGG - Intronic
940014295 2:149087232-149087254 TTTCTTCAGGGGAAGGGAGAAGG - Intronic
940216035 2:151304495-151304517 GGTTGCCAGGGGATGAGGGAAGG + Intergenic
940752773 2:157645929-157645951 TGTGGTCGGGGGAGGGGGGAGGG + Intergenic
941670654 2:168288932-168288954 ATTGTTCAGGGGATGGGGGGCGG - Intergenic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941855588 2:170227282-170227304 TTTTGTGAGGGGAAGTGGGGGGG + Intronic
942271024 2:174275427-174275449 TTTTGTGGGGGGAGTGGGGAGGG - Intergenic
942717910 2:178915163-178915185 TTTTTTCAGGGGGTGGGGACAGG - Intronic
942724405 2:178990782-178990804 GCTTGCCAGGGGCTGGGGGAAGG + Intronic
942814431 2:180034736-180034758 TGCTATCAGGGGATGGGGGAGGG + Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
943095633 2:183425799-183425821 TTGGGTGGGGGGATGGGGGAGGG - Intergenic
943177553 2:184496506-184496528 GTCTGTTAGGGGCTGGGGGAGGG + Intergenic
943460188 2:188163660-188163682 GTTTGTCAGGGGCTAAGGGATGG + Intergenic
943654034 2:190488359-190488381 GGTTGTCAGGGGATGGGACAAGG + Intronic
943762909 2:191629330-191629352 AGTTGCCAGGGGCTGGGGGAAGG - Intergenic
943798559 2:192029153-192029175 CTTTCTTAGGGGTTGGGGGAAGG + Intronic
944103083 2:196050323-196050345 GTTTGCCAGGAGGTGGGGGAGGG + Intronic
944162649 2:196681119-196681141 TGTTGTCAGGGGCTGGGAGAAGG - Intronic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
944617949 2:201482166-201482188 TTTTACCATGGGGTGGGGGATGG + Intergenic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944843660 2:203646985-203647007 TATTGGCACAGGATGGGGGAGGG + Intergenic
945776844 2:214115927-214115949 TTTTGTCTGTGGATGGGTGCAGG - Intronic
945891640 2:215436349-215436371 ACTTTTTAGGGGATGGGGGAAGG + Intergenic
946003275 2:216500964-216500986 CTTTTTCATGGGATGGGGTAGGG + Intronic
946367212 2:219255799-219255821 TGTTGTCAGGTGATGGGGGAGGG - Intronic
946740295 2:222794565-222794587 ATTTGACAGGGGGTGGGGGAAGG + Intergenic
946807422 2:223485198-223485220 TTTAGTCTGGGTATGTGGGATGG - Intergenic
946996018 2:225392313-225392335 GTCTGTCAGGGGGTGGGGGTAGG + Intergenic
947379531 2:229531979-229532001 GGTTGACAGGGGTTGGGGGAAGG + Intronic
947497898 2:230651990-230652012 TGGTGCCAGGGGCTGGGGGAGGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947610695 2:231523415-231523437 TCTTGCCAGGGAATGGGGGAAGG - Exonic
947744851 2:232502241-232502263 ATCTGCCAGGGAATGGGGGAGGG + Intergenic
947763253 2:232619258-232619280 TGTTGCCAGGGGATGGGAGGAGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948089474 2:235280558-235280580 TGTTGACAGAGGATGGGGGTGGG - Intergenic
948245657 2:236483047-236483069 GGTTGTCAGGGACTGGGGGAAGG - Intronic
948384452 2:237572927-237572949 CCCTGGCAGGGGATGGGGGAGGG - Intergenic
948504494 2:238419064-238419086 TTCAGCCAGGGGTTGGGGGAGGG - Intergenic
948636497 2:239341194-239341216 TTTTGTGAAAGGATCGGGGAGGG - Intronic
948862213 2:240758146-240758168 TTATTTCAGGGGACGTGGGATGG - Intronic
1169006805 20:2214155-2214177 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
1169260032 20:4130753-4130775 TGTTTTCAGAGGCTGGGGGAAGG + Intronic
1169785503 20:9355435-9355457 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1170717711 20:18846551-18846573 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1170809969 20:19666499-19666521 TTTTTTTGGGGGGTGGGGGATGG - Intronic
1171189185 20:23146615-23146637 TTTTGGCGGGGGGTGGGGGGTGG - Intergenic
1171354304 20:24532442-24532464 GTTTGCCAGGGGCTGGGGAAAGG + Intronic
1171356757 20:24552448-24552470 TGGGGTGAGGGGATGGGGGAGGG - Intronic
1171402746 20:24888942-24888964 TGTTGCCAGGGGCTGGGGGGAGG + Intergenic
1171434776 20:25112814-25112836 TGTTGTCGGGGGAGGGGGGAGGG + Intergenic
1171774360 20:29351552-29351574 TTTTTGCAGGGGATGGGGTGCGG - Intergenic
1171913661 20:30991304-30991326 TTTTGGGGGGGGAGGGGGGAGGG + Intergenic
1172044109 20:32067390-32067412 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172389556 20:34557927-34557949 TTTTTTTGGGGGAGGGGGGAGGG - Intronic
1173044528 20:39497034-39497056 TTTTGACATGGAATGGGGAATGG - Intergenic
1173225285 20:41159061-41159083 CTTGGTCAGGGGATGGGGTGGGG + Intronic
1173313030 20:41917377-41917399 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1173426420 20:42947350-42947372 TGCTGCCAGGGGCTGGGGGAAGG - Intronic
1174026457 20:47580557-47580579 TTTTTTGGGGGGATGGGGGTGGG - Intronic
1174553730 20:51379484-51379506 GTCTGTCGGGGGTTGGGGGAGGG - Intergenic
1174753803 20:53138576-53138598 TGTTGGCAGGGGTTGGGGGGTGG - Intronic
1174848575 20:53968377-53968399 TGGTGTCAGGGGGTAGGGGAAGG + Intronic
1174905520 20:54546539-54546561 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1174933459 20:54841675-54841697 GCCTGTCGGGGGATGGGGGATGG - Intergenic
1175236643 20:57517645-57517667 TTTTGTCACGGGATGGGATGAGG + Intronic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1175923874 20:62462637-62462659 TCTGGCCTGGGGATGGGGGACGG - Intergenic
1175969493 20:62677119-62677141 TGGTGCCAGGGGCTGGGGGAAGG + Intronic
1176017429 20:62942497-62942519 TTATGTCAGGGGCAGGGGAAGGG + Intronic
1176588232 21:8611118-8611140 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177060688 21:16370180-16370202 TTTTCCTGGGGGATGGGGGAGGG + Intergenic
1177148673 21:17432933-17432955 TTGGGGCGGGGGATGGGGGATGG - Intergenic
1177287129 21:19065734-19065756 TTTTGTGACAAGATGGGGGAAGG - Intergenic
1177332280 21:19679903-19679925 TTTTTTCGGGGGGTGGGGGGAGG + Intergenic
1177367608 21:20157727-20157749 TGGGGTGAGGGGATGGGGGAGGG - Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1177836850 21:26193990-26194012 ATTTGTGCAGGGATGGGGGACGG + Intergenic
1178359527 21:31936574-31936596 TTTTCTTAGGGGATGGGAGTTGG + Intronic
1178566722 21:33693358-33693380 TTTGGTGGGGGGGTGGGGGATGG + Intronic
1178938707 21:36886654-36886676 TTTTGACAGAGGGTTGGGGAGGG - Intronic
1179179202 21:39030950-39030972 GGTTGTCAGGGGCTGGGGGGAGG + Intergenic
1179477001 21:41653362-41653384 TGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1179610784 21:42548516-42548538 TTCTGTGAGGGGATGTGGAATGG + Intronic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180271064 22:10588117-10588139 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180484030 22:15778930-15778952 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1180883148 22:19220909-19220931 ATTGGTCAGGTGATGGGGAAGGG + Intronic
1181017254 22:20078332-20078354 TTTTGTAGGGGGTTGGGGGCCGG + Intergenic
1181389565 22:22570547-22570569 TGTTGTGGGGGGAGGGGGGAGGG - Intergenic
1181637765 22:24182190-24182212 TTTTGATGGGGGATGGGGAAGGG + Intronic
1181663365 22:24370904-24370926 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1181823411 22:25493741-25493763 GTTTGTCGGGGGAGTGGGGAGGG + Intergenic
1182414319 22:30211194-30211216 TGTTGCCAGGGGCTGGGGAAGGG + Intergenic
1182427742 22:30283797-30283819 TTTTGTTGGGGGAGGGGGGTTGG - Intergenic
1182554253 22:31120450-31120472 TCTTGTCAGGAGAAGGGGGTAGG - Intergenic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183096861 22:35557428-35557450 TTTCATCTGGGGATGGGGGTTGG - Intergenic
1183110280 22:35643772-35643794 TGTGTTGAGGGGATGGGGGATGG - Intergenic
1183118414 22:35710707-35710729 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1183128293 22:35806807-35806829 TTTTTTCGGGGAGTGGGGGACGG + Intronic
1183142114 22:35952091-35952113 TTTTGGCTGGGGATGGTGAAGGG - Intronic
1183183745 22:36279494-36279516 GGTTGTCAAGGGCTGGGGGAGGG + Intergenic
1183215078 22:36474200-36474222 TGTTTACAGGGGCTGGGGGAGGG - Intronic
1183536345 22:38403797-38403819 TTGTGTCTGGGAATGGGGGTGGG + Intergenic
1183655699 22:39183469-39183491 TTTTGGCGGGGGAATGGGGATGG + Intergenic
1183914853 22:41109719-41109741 TTTTGGCAGGGGGAGGAGGACGG + Intronic
1184031199 22:41895841-41895863 TGTTGAAAGGGGATGGGGGCTGG + Intronic
1184199284 22:42954783-42954805 TGATGCCAGGGAATGGGGGATGG + Intronic
1184628585 22:45757289-45757311 TTTTGTGTGGGGCTAGGGGAGGG - Intronic
1184962374 22:47940880-47940902 TTTTGTTGTGGGGTGGGGGACGG + Intergenic
1184966165 22:47973743-47973765 GTTTGGCAGGGGGTGGGGGAAGG + Intergenic
1184998181 22:48225865-48225887 TATTGTCAGGATGTGGGGGAGGG - Intergenic
1185009351 22:48304647-48304669 TTTTGATGGGGGAAGGGGGATGG - Intergenic
1185067326 22:48638892-48638914 TAGTGTCGGGGGATGGGGGGGGG - Intronic
1185157478 22:49202903-49202925 TGTTGTCAGGTGATGGGGACAGG - Intergenic
949493898 3:4613631-4613653 TTTTGTCAGGGTTTGGAGGTTGG - Intronic
949950567 3:9225603-9225625 GTTTGCCAGGGGATGGGGTTGGG - Intronic
950070787 3:10150540-10150562 TTTTGTTGGGGGGTGGGAGAGGG + Exonic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950642058 3:14354731-14354753 TTTTTTCTGGAGGTGGGGGATGG - Intergenic
950701546 3:14753338-14753360 TGGGGTCAGGGGCTGGGGGAGGG + Intronic
950795261 3:15505435-15505457 TCTTGTCAGGGAAAGGGGGATGG - Intronic
951379694 3:21968458-21968480 TTCTGCCTGGGGCTGGGGGAGGG - Intronic
951477788 3:23126782-23126804 TGTTGTCAGGAGTTGGGGAAAGG - Intergenic
951479540 3:23144862-23144884 GCTTGTCAGGGGGTGGGGGCTGG + Intergenic
951562205 3:23980336-23980358 TTTTTTTAGGGGTTGGGGGAGGG + Exonic
951672094 3:25196211-25196233 TGGGGTGAGGGGATGGGGGAGGG - Intronic
951721148 3:25699598-25699620 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
952050225 3:29376183-29376205 TCTTGTCAGAGGGTGGGGGGTGG + Intronic
952082757 3:29781106-29781128 TATTCTCGGGGGAGGGGGGAGGG - Intronic
952143945 3:30511325-30511347 TTTTTTTGGGGGGTGGGGGACGG + Intergenic
952381031 3:32805579-32805601 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
952768080 3:36972542-36972564 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
952861274 3:37814557-37814579 TTTTTTGGGGGGGTGGGGGATGG - Intronic
952875629 3:37941977-37941999 TTAAGTAAGGGGATTGGGGAGGG + Intronic
953168770 3:40488657-40488679 TTTTTTTAGGGGGTGGGGGGTGG + Exonic
953301345 3:41779835-41779857 TGTGGTCGGGGGAGGGGGGAGGG + Intronic
953332679 3:42066859-42066881 CTTTTTCAGGGGCTGGGGGGAGG + Intronic
953716251 3:45319257-45319279 TTTTTCCTGGGGCTGGGGGAGGG - Intergenic
953813017 3:46130529-46130551 ATATGTCAGGGGATGAGGGTAGG + Intergenic
953933022 3:47015969-47015991 TTTTGGGGGGGGGTGGGGGAGGG - Intergenic
953960236 3:47260833-47260855 GTTTGCCAGGTGATGGGGAAGGG + Intronic
954489938 3:50893973-50893995 TTAGGTGAGGGGAGGGGGGAGGG + Intronic
954572494 3:51653781-51653803 TGGTGTGGGGGGATGGGGGAGGG + Intronic
954601346 3:51872857-51872879 GGTTGTCAGGGGCTAGGGGAGGG + Intergenic
954825043 3:53365442-53365464 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955300854 3:57777099-57777121 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
955434543 3:58888558-58888580 GCTTGTCAGGGGTTGGGGAAAGG - Intronic
955439202 3:58937354-58937376 ATCTGACTGGGGATGGGGGAAGG - Intronic
955655793 3:61243478-61243500 CTTTGACAGAGGATGGGGGTAGG + Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956034606 3:65077514-65077536 GGTTGCCAGGGGATGGGGGTAGG + Intergenic
956044997 3:65186238-65186260 GTTTGTCAGGGGTTTGGGGGTGG - Intergenic
956529891 3:70206506-70206528 ATTTTACAGGGGATGGGGGTTGG + Intergenic
956628831 3:71294093-71294115 TGTTATCAGGGGATGGCGGGAGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957164855 3:76659268-76659290 TATTTCCAGGGGTTGGGGGAAGG + Intronic
957250264 3:77763819-77763841 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
957500502 3:81051535-81051557 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
957699268 3:83687826-83687848 TACTGTCAGGGGTTGGGGAAAGG + Intergenic
957766277 3:84629173-84629195 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
957817237 3:85317128-85317150 TTTTTTGGGGGGATGGGGGGTGG + Intronic
957917342 3:86703440-86703462 GCCTGTCAGGGGATGGGGGCTGG - Intergenic
958067863 3:88567679-88567701 TATTGTCAGTGGCTGGGAGAAGG + Intergenic
958098033 3:88972997-88973019 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958180951 3:90060458-90060480 TTTTGTTGGGGGGTGGGAGAGGG + Intergenic
958691404 3:97472143-97472165 TTTTTTGAGGGGAGGGGGAAAGG + Intronic
958701121 3:97591559-97591581 TTTTGTTGGTGGGTGGGGGAGGG + Intronic
958703439 3:97622257-97622279 GTTTGCCAGGGGCTGGGGGAAGG - Intronic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
958906316 3:99945728-99945750 TTTTGCTAGGGGTTGGGGGCTGG + Intronic
959571478 3:107888958-107888980 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
959640252 3:108623977-108623999 TGTAGTCAGGGGATGGAGGAAGG + Intronic
959651474 3:108755262-108755284 TGGGGTCGGGGGATGGGGGAGGG + Intronic
959846835 3:111042714-111042736 TAGGGTCAGGGGAGGGGGGATGG - Intergenic
960049080 3:113223616-113223638 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
960440698 3:117683981-117684003 TCTTGGCATGGGATGGGGGGTGG + Intergenic
960739145 3:120813760-120813782 TTTTGGCAGAGAATGGGGAAAGG + Intergenic
960976351 3:123178352-123178374 TGGGGTGAGGGGATGGGGGAGGG + Intronic
961039188 3:123664951-123664973 GGTTGTCAGGGCCTGGGGGAAGG + Intronic
961118130 3:124349300-124349322 GGTTGTCAGAGGCTGGGGGAAGG + Intronic
961224137 3:125223948-125223970 TTTTTTCGGGGGGAGGGGGATGG - Intergenic
961302718 3:125932601-125932623 TTTGGTTGGGGGATGGTGGAGGG - Intronic
961885347 3:130093187-130093209 TTTGGTTGGGGGATGGTGGAGGG + Intronic
961929547 3:130518169-130518191 TTTTGCCAGTGGATGGGTGTGGG + Intergenic
961992461 3:131206824-131206846 TGGGGTGAGGGGATGGGGGAGGG - Intronic
962063504 3:131954645-131954667 GCCTGTCATGGGATGGGGGAAGG - Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
962549840 3:136479218-136479240 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
963333153 3:143938928-143938950 TCCTGTCAGGGGATGGGGATGGG + Intergenic
963386451 3:144600242-144600264 TTTTTTCAGCTGTTGGGGGATGG - Intergenic
963395663 3:144730272-144730294 TGGGGTCGGGGGATGGGGGAAGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964181137 3:153887789-153887811 GATTGCCAGGGGCTGGGGGAAGG + Intergenic
964189293 3:153983539-153983561 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
964528229 3:157638804-157638826 TTTTGGCAGGGTATGTGGGAGGG - Intronic
964957450 3:162379194-162379216 TGGTGTGGGGGGATGGGGGAGGG - Intergenic
965037972 3:163467322-163467344 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
965152114 3:164990747-164990769 TGTGGTAGGGGGATGGGGGAGGG + Intronic
965304876 3:167051793-167051815 TTTTCTCCTGGGATGGGGGTGGG - Intergenic
965316959 3:167204382-167204404 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
965604449 3:170484827-170484849 TTTCCTCTGGGGATGGGGCAGGG + Intronic
965809353 3:172576307-172576329 GCCTGTCAGGGGATGGGGAAGGG + Intergenic
966300046 3:178468766-178468788 GATTGTCAGGGGTTGGGGGAGGG + Intronic
967505739 3:190250989-190251011 TTGTGTCAGTGGGTTGGGGAGGG - Intergenic
967900039 3:194440505-194440527 GCTTGTTGGGGGATGGGGGATGG - Intronic
967976778 3:195039926-195039948 TTTTGATGGGGGATGGGGGATGG + Intergenic
968536924 4:1137914-1137936 GTTTGTCATGGGCTGGGGGGAGG - Intergenic
968723272 4:2223508-2223530 TTTTTCCACGGGATGGGGGTCGG - Intronic
968822148 4:2862487-2862509 TTTTGTTTGGGAATGGGAGAGGG - Intronic
968884275 4:3318882-3318904 TTGTGACAGGTGATGGGGGTGGG + Intronic
969338428 4:6525704-6525726 CTTTTTGGGGGGATGGGGGAGGG + Intronic
969374222 4:6752706-6752728 GGTTGCCAGGGAATGGGGGAAGG + Intergenic
969503752 4:7570819-7570841 TATTGGCAGGGGATGGGGGTGGG + Intronic
969531082 4:7730715-7730737 TGTTGCCAGGGGCTGGGGGAGGG + Intronic
969692805 4:8713823-8713845 GTCTGTCAGGGAATGGGGTAGGG + Intergenic
969819401 4:9708855-9708877 TTTGGTTGGGGGATGGCGGAGGG - Intergenic
970183372 4:13422742-13422764 GCCTGTCATGGGATGGGGGACGG + Intronic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970846453 4:20544024-20544046 TGGTGTGGGGGGATGGGGGAGGG + Intronic
971056901 4:22923282-22923304 TTTTGTGTGGGGTTGGAGGAGGG - Intergenic
971381944 4:26107253-26107275 ATTTGTTAGGGCATGTGGGATGG - Intergenic
971447882 4:26771638-26771660 TGTTGCCAGGGGATGGGGGAGGG + Intergenic
971506831 4:27375830-27375852 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971890626 4:32516977-32516999 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
972052315 4:34753166-34753188 TGTTGCCAGGGGATGGGGGTAGG + Intergenic
972603251 4:40591168-40591190 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
972619921 4:40737214-40737236 TTTTGCCAGGGGTGGGGGGAAGG + Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
972801296 4:42478273-42478295 TTGAGTCTGGGGCTGGGGGATGG + Intronic
972943933 4:44229968-44229990 GCCTGTCAGGGGGTGGGGGAGGG - Intronic
973656778 4:53056137-53056159 TTTTTTCAGGTCATAGGGGAAGG + Intronic
974070027 4:57114873-57114895 GATTGTCAGGTGATGGGGTAGGG + Intergenic
974114346 4:57562458-57562480 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974262857 4:59546274-59546296 TTGAGTCAGGGGATCGGGAAAGG - Intergenic
974347673 4:60702778-60702800 TTTTGTCAGTGGATGGTTCAAGG + Intergenic
974632493 4:64511435-64511457 TACTGCCAGAGGATGGGGGAGGG + Intergenic
974726518 4:65806104-65806126 TTTTTTCTGGGTATGGGGCAGGG + Intergenic
974887618 4:67839972-67839994 TGTTGTCGGGGGAGGGGGGAGGG - Intronic
974969364 4:68805204-68805226 TTGTTTCAGGGGAGGGGGAAGGG - Intergenic
975598761 4:76077190-76077212 GGTTGCCAGGGAATGGGGGATGG - Intronic
975758215 4:77592409-77592431 GGTTGTCAGGGGTTGGGGGAAGG + Intronic
975813157 4:78190590-78190612 TGTGGTGGGGGGATGGGGGATGG - Intronic
975829461 4:78353848-78353870 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976347806 4:84025423-84025445 TTTTATCTGGGGGTGGGGGGTGG + Intergenic
976908178 4:90266604-90266626 TACTGTCAGAGAATGGGGGAGGG - Intronic
977202493 4:94133124-94133146 TTTTGTTGGGGGGGGGGGGATGG + Intergenic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977501046 4:97837406-97837428 TTTAGTCATGGGTTGGGGGCAGG - Intronic
977837487 4:101662390-101662412 TTTTGTCAGGGGTTAGGGGAGGG + Intronic
978022050 4:103826579-103826601 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
978234035 4:106436140-106436162 TTTTGTCACAGGATGGGGCAGGG + Intergenic
978258163 4:106718095-106718117 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
978287693 4:107098272-107098294 TGCTGCCAGGGGATGGTGGAGGG - Intronic
978585082 4:110268540-110268562 GGCTGTCAGGGGTTGGGGGAAGG + Intergenic
978617190 4:110609848-110609870 TTCTGGCAGGGGATGGAGGGTGG - Intergenic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
979470347 4:121088791-121088813 CTTTGCCAGGGGTTGGGGGTAGG + Intergenic
979517203 4:121623362-121623384 TGTTATCAGGGGCAGGGGGAGGG - Intergenic
979758149 4:124367232-124367254 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
979913254 4:126397006-126397028 TATTGCCAGGGGATAGAGGAGGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980329879 4:131397800-131397822 GCTTATCAGGGGTTGGGGGATGG - Intergenic
980510940 4:133786800-133786822 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980572593 4:134639977-134639999 TTTTGGCAGGGGGTGGGTGGGGG + Intergenic
980760074 4:137221380-137221402 GATTGCCAGGGGATAGGGGAGGG + Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
981481899 4:145247349-145247371 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
981680011 4:147386577-147386599 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
982415472 4:155126080-155126102 GTTTGTCAGGGGTTGTGGGGAGG + Intergenic
982638023 4:157921788-157921810 TGGGGTGAGGGGATGGGGGAGGG - Intergenic
982683501 4:158460003-158460025 TGCTGCCAGGGGATGAGGGATGG + Intronic
982762103 4:159297234-159297256 TTTTTTTGGGGGTTGGGGGAAGG - Intronic
984054555 4:174910615-174910637 TTTTGTCTGGAGGTGGGGCAGGG + Intronic
984130261 4:175866432-175866454 TGTTGTCAGGGGTTGAGGGATGG - Intronic
984210390 4:176840203-176840225 ATTTGTCGGGGGATGGGGGAGGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984339041 4:178430101-178430123 TTTTGCCTGGTGATGGGAGAAGG + Intergenic
984612723 4:181858657-181858679 ATATGCCAGGGGATGGAGGAGGG + Intergenic
984668331 4:182452323-182452345 TTTTGGCAGGGGACGGGGGGCGG + Intronic
985009856 4:185570950-185570972 GGTTGCCAGGGGATGGGTGAAGG + Intergenic
985417250 4:189749017-189749039 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
985938022 5:3111620-3111642 CTTCCTCAGGGGATGGGGGTGGG - Intergenic
986021794 5:3811589-3811611 GGTTGTCAGGGGTTGGGGGAAGG + Intergenic
986217157 5:5730202-5730224 GGTTGCCAGGGGGTGGGGGAAGG - Intergenic
986223514 5:5791826-5791848 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
986574872 5:9201367-9201389 TTTTGTCTGGGGGTGGGACAGGG - Intronic
986769649 5:10960639-10960661 TGTTGTCAGGGGCTGGGGGAAGG + Intergenic
986832138 5:11591979-11592001 TAATGTCAGGGGTTGGGGGGTGG - Intronic
987480069 5:18442156-18442178 GTTTGCCAGGGGATTAGGGAAGG + Intergenic
987521264 5:18986832-18986854 GTTTGTTTGGGGGTGGGGGAGGG - Intergenic
987578917 5:19763098-19763120 TGGGGTCTGGGGATGGGGGAGGG + Intronic
987668705 5:20980760-20980782 TTGTGTCAGTGGACTGGGGAAGG - Intergenic
987959016 5:24779947-24779969 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
988024150 5:25662918-25662940 TTTTGTCAAGGGCTAGGGGCTGG + Intergenic
988222120 5:28361067-28361089 GATTGCCAGGGGATAGGGGAGGG + Intergenic
988251292 5:28760985-28761007 TGGGGTCGGGGGATGGGGGAAGG + Intergenic
988305605 5:29490159-29490181 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
989169135 5:38457931-38457953 GGTTGTCAGGGGCTGGGGGGAGG + Intronic
989205603 5:38806354-38806376 TTTTGACAGGGGTTTGGGGGTGG - Intergenic
989215466 5:38900282-38900304 TGCTGCCAGGGAATGGGGGAGGG + Intronic
989240804 5:39201587-39201609 TTTTGTTGGGGGAAGGGAGAGGG - Intronic
989334240 5:40296881-40296903 TGGTGTCCGGGGCTGGGGGAGGG - Intergenic
989502353 5:42182745-42182767 TGCTGCCAGGGGATGAGGGAGGG - Intergenic
989616976 5:43346825-43346847 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
989657828 5:43762931-43762953 TCTTGTTGGGAGATGGGGGAAGG + Intergenic
989690904 5:44142948-44142970 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
989989031 5:50739384-50739406 TTTTGTGGGGGGATGGGGGTGGG + Intronic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
990759946 5:59117819-59117841 TTTTGTGAGGGGTGGTGGGATGG + Intronic
990966783 5:61457046-61457068 TGGGGTCGGGGGATGGGGGAGGG - Intronic
991030259 5:62074947-62074969 TTTAGTCAGTTGTTGGGGGAGGG + Intergenic
991140037 5:63230088-63230110 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
991243264 5:64483094-64483116 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991309206 5:65216413-65216435 AGTTGCCAGGGGATGGGGAATGG + Intronic
991606841 5:68411039-68411061 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
991962590 5:72060131-72060153 GGTTGACAGGGGCTGGGGGAGGG + Intergenic
992028849 5:72700524-72700546 TGTGGTGGGGGGATGGGGGAGGG - Intergenic
992087470 5:73290927-73290949 TTTTGGTAGGGGATGGGGCCAGG + Intergenic
992789516 5:80201092-80201114 TTTTGTGGGGGGGTGGTGGATGG - Intronic
992995644 5:82329687-82329709 CTTTGGCAGGGGTCGGGGGAGGG + Intronic
993310901 5:86330937-86330959 TGACGTCAGGGGATGGAGGATGG + Intergenic
993511190 5:88773375-88773397 TTATGTACGAGGATGGGGGATGG - Intronic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
994626435 5:102226012-102226034 TGTTGTCAAGGGAGTGGGGAAGG - Intergenic
995489165 5:112671971-112671993 AGTTGCCAGGGGTTGGGGGAAGG - Intergenic
996961626 5:129256410-129256432 TTCTGCCAGTGGATGGGGGAGGG + Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997269020 5:132519833-132519855 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
997471152 5:134117624-134117646 TGCTGTCAGGGTATGGGTGATGG + Intronic
998137407 5:139681504-139681526 TGGGGTCAGGGGATGGGGGTGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998660764 5:144234840-144234862 TTTTGTCTGTGGAAGGGGGCAGG - Intronic
998663901 5:144273757-144273779 TGTTGTCAGGGGCTGGGGGGAGG + Intronic
999379858 5:151112956-151112978 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
999677842 5:154023136-154023158 TGGGGTCAGGGGATGGGGGAGGG + Intronic
999897202 5:156047963-156047985 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1000132258 5:158310911-158310933 TTTTGGCGGGGGCTGGGGGGTGG - Intergenic
1000598446 5:163243474-163243496 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1000621284 5:163489440-163489462 TATTGTCGGGGGAGGGGGAAAGG - Intronic
1000717509 5:164664449-164664471 GGTTTACAGGGGATGGGGGAAGG + Intergenic
1000944393 5:167402613-167402635 TCATGTTAGGGGATGGGAGAAGG - Intronic
1001123136 5:168996370-168996392 CATTTTCAGTGGATGGGGGAAGG + Intronic
1001160758 5:169310785-169310807 GTCTGTCATGGGGTGGGGGATGG - Intergenic
1001632532 5:173186723-173186745 GGTTGTCAGGGCCTGGGGGAAGG - Intergenic
1001770477 5:174292404-174292426 ATTTGTCTGGGGAGGGGGAATGG - Intergenic
1002095258 5:176826995-176827017 GTTTGCCAGGGGCTGGGGCAAGG - Intronic
1002220518 5:177676399-177676421 GTTTTTCAGGGGTTGGGGAAGGG + Intergenic
1002328781 5:178427785-178427807 CGTTGCCAGGGGCTGGGGGAGGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002362242 5:178681691-178681713 GGTTGTCAGGGGCTGGGGGGCGG - Intergenic
1002844067 6:930534-930556 TTTTCTCAGGGGCAGGGAGATGG + Intergenic
1003376716 6:5585477-5585499 GGTTGCCAGGGGATGGGGGTGGG - Intronic
1003509843 6:6770633-6770655 TGTTGCCAGGGGTTGAGGGAAGG + Intergenic
1003800693 6:9663388-9663410 TTTTGTGATGGGGTGGGGAAGGG + Intronic
1003903112 6:10673524-10673546 GGTTGCCAGGGGATGAGGGAAGG + Intronic
1004026104 6:11820189-11820211 TTTTTTTGGGGGATGGGGGCAGG - Intergenic
1004103588 6:12641786-12641808 GCTTGTCAGGGGGTGGGGGGTGG - Intergenic
1004490841 6:16113807-16113829 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1004660011 6:17701967-17701989 TTTTGTCCCGGGATGGGGGTGGG - Intronic
1004810331 6:19252932-19252954 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1004813469 6:19286594-19286616 TGGTGACAGGGGCTGGGGGAGGG + Intergenic
1005380226 6:25225964-25225986 TTGTCTCAGGGGGCGGGGGAAGG + Intergenic
1005493589 6:26369468-26369490 TTGTGTTAGGGGATTGGGGCCGG + Intronic
1005694532 6:28339299-28339321 TTTTGGCAGGGGAGTGGGGAAGG + Intronic
1006163608 6:32051905-32051927 TGTTGCCAGGGGCTGGGGCAAGG + Intronic
1006602907 6:35237707-35237729 ACTTGTGAGGGGATGGGGGTTGG + Intronic
1006635752 6:35460112-35460134 TTTTGGCGGGGGGTGGGGGGTGG + Intronic
1006729427 6:36225250-36225272 TTCTGCCTGGGGGTGGGGGAGGG - Exonic
1007171394 6:39866024-39866046 TTTCGCCAGGGGAAGGGTGAAGG - Intronic
1007245805 6:40461570-40461592 TTTTGTCGGGGGGAGGGGGGTGG - Intronic
1007360945 6:41355108-41355130 TGGGGTCAGGGGACGGGGGAGGG + Intergenic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007508231 6:42354152-42354174 TTGTGTCAGTGCTTGGGGGAAGG + Intronic
1007586550 6:42993856-42993878 TTTGGTGAGGGGAGGGGGTAGGG + Intronic
1007607411 6:43126937-43126959 TTGTGTCAGGAGATGTGGGCTGG + Intronic
1008566156 6:52770615-52770637 TGTTGACAGGGGATGGAGAAAGG - Intergenic
1008752964 6:54758546-54758568 GTGCTTCAGGGGATGGGGGAGGG + Intergenic
1008770533 6:54973235-54973257 TTTTTTGGGGGGATGGGGGTGGG + Intergenic
1008843037 6:55927745-55927767 GCCTGTCAGGGGATGGGGGTGGG - Intergenic
1008973603 6:57399181-57399203 TGGGGTCAGGGGATGGAGGAGGG - Intronic
1009162499 6:60300733-60300755 TGGGGTCAGGGGATGGAGGAGGG - Intergenic
1009272286 6:61628583-61628605 TTTGGTCAGTGGAGAGGGGATGG - Intergenic
1009276968 6:61695203-61695225 TTTTGTCAGGAGGTGGGAGCAGG - Intronic
1009348885 6:62649889-62649911 TTGAGTCAGTGGATTGGGGAAGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1009791516 6:68407336-68407358 TGTTGTCAGGGGATAGGAGAAGG + Intergenic
1010171259 6:72978818-72978840 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1010227584 6:73505481-73505503 GGTTACCAGGGGATGGGGGAGGG + Intronic
1010315781 6:74448468-74448490 TTTTGCCAGGGGCTGGAGGGAGG - Intergenic
1010344035 6:74790464-74790486 TGTGGTCAGGGGAGGGGGGAAGG + Intergenic
1010392430 6:75353056-75353078 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1010505554 6:76654150-76654172 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1010512517 6:76737918-76737940 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1010643598 6:78360194-78360216 GCTTGTCATGGGGTGGGGGAGGG + Intergenic
1010739399 6:79482318-79482340 TTTTTGCAGGGGGTGGGAGAAGG + Intergenic
1010858888 6:80879715-80879737 GCTAGGCAGGGGATGGGGGAAGG - Intergenic
1011065244 6:83319153-83319175 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1011291297 6:85779863-85779885 TGCTGTCATGGGATGGGGGAGGG + Intergenic
1011441843 6:87395696-87395718 GGTTGCCAGGGGTTGGGGGAAGG + Intronic
1011785515 6:90839517-90839539 TGTTGTCAGAGGCTGGGAGATGG - Intergenic
1011834745 6:91417852-91417874 TGATGCCAGGGGATGGGGGCAGG + Intergenic
1012089719 6:94875813-94875835 TGTTGTCGGGGGAGTGGGGAGGG - Intergenic
1012184307 6:96194053-96194075 TAGTGTCAGGGGAGAGGGGAGGG + Intronic
1012222360 6:96664398-96664420 GGTTCTCAGGGGCTGGGGGAAGG - Intergenic
1012288530 6:97422617-97422639 TGCTGCCAGGGGATGGAGGACGG + Intergenic
1013023837 6:106249264-106249286 ATTTTTCAGGGGCTGGGGCAAGG - Intronic
1013314658 6:108929953-108929975 TTTTGGCAGGGGTTGGGGGTGGG - Intronic
1013444940 6:110215574-110215596 GATTGTCAGAGTATGGGGGATGG + Intronic
1013513705 6:110866705-110866727 GTTTTTCAGAGGGTGGGGGAAGG + Intronic
1013536422 6:111066901-111066923 TTTAGGCAGGGAAAGGGGGAAGG + Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013653874 6:112224964-112224986 TTTTGGCAGGGGACGGGGAAGGG + Intronic
1013656075 6:112248061-112248083 TGTTGCCAGGGGCTGGAGGAAGG + Intronic
1013696600 6:112709616-112709638 TTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1013712154 6:112914507-112914529 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1013726726 6:113106871-113106893 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1014021569 6:116596448-116596470 TTGTGTCAGAGGATGGATGATGG + Exonic
1014039943 6:116814603-116814625 TGTGGTGGGGGGATGGGGGAGGG + Intronic
1014703513 6:124718243-124718265 AGTTGCCAGGGGATGGGAGAAGG - Intronic
1014879811 6:126709772-126709794 TTTAGTCAGTGGACTGGGGAAGG - Intergenic
1014965475 6:127742749-127742771 GGTTGTCAGGGGCTGGGGGTGGG + Intronic
1015108089 6:129560167-129560189 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1015474777 6:133648153-133648175 TTTTTTTAGAGGATGGGGTATGG - Intergenic
1015525221 6:134169310-134169332 TTGTGTGATGGGATGAGGGAAGG + Exonic
1015732854 6:136365903-136365925 TGTTGCCGGGGGATGGGGGCCGG + Exonic
1015741314 6:136457324-136457346 TTGGGGCAGGGGATGGGGGCGGG - Intronic
1015778574 6:136839948-136839970 ATTTGTCTGGGGAAGGGGCAGGG + Intronic
1015779050 6:136844657-136844679 GTTTGCCAGGGGCTGGGGGTGGG - Intronic
1015887655 6:137935165-137935187 GGTTGCCAGGGGATGGTGGAAGG - Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016457477 6:144245822-144245844 TCCTGCCAGGGGATGGGGAAAGG + Intergenic
1016479628 6:144468201-144468223 TTAGGTCACAGGATGGGGGATGG + Intronic
1016541360 6:145169908-145169930 CATTGCCAGGGGGTGGGGGAGGG - Intergenic
1016593388 6:145770721-145770743 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1016610225 6:145980802-145980824 TGTGGTGGGGGGATGGGGGAGGG - Intergenic
1016932899 6:149427306-149427328 TTTTGGCAGGGGATGGGGGTTGG + Intergenic
1017141589 6:151195786-151195808 GGTTGTCAGGGGTTGGAGGATGG + Intergenic
1017368500 6:153674775-153674797 TTTTGTGAAGTGATGGAGGAGGG + Intergenic
1017518644 6:155181634-155181656 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1017661779 6:156681887-156681909 GGTTGCCAGGGGATGGGAGAAGG + Intergenic
1017816380 6:158019386-158019408 TTTTCCCCTGGGATGGGGGAAGG - Intronic
1017997696 6:159547354-159547376 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1018085344 6:160296905-160296927 TGTTATCAGGGGCTGAGGGAGGG - Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018428968 6:163708660-163708682 TTTTGTCACGGAAGGAGGGATGG + Intergenic
1019021140 6:168918685-168918707 TTCGGGCAGGAGATGGGGGAGGG + Intergenic
1019663472 7:2239328-2239350 CTTTGCCAGTGGATGCGGGATGG - Intronic
1020021565 7:4872455-4872477 TTTTGTCAGGGGCTGGGGAACGG - Intronic
1020140650 7:5609701-5609723 CATTATCAGGGGGTGGGGGAGGG + Intergenic
1020461092 7:8431036-8431058 TTTTGGCAGGGGAGAGGGAAGGG - Intergenic
1020485524 7:8715295-8715317 TGCTGTGAGGGGATGGGGTAAGG + Intronic
1020697365 7:11430364-11430386 GGTTGTCAGGGGATGAGGAAGGG - Intronic
1021214754 7:17901670-17901692 TTCTGCCAGGGGATGAGGGAGGG + Intronic
1021771695 7:24009117-24009139 GCCTGTCAGGGGATGGGGGGTGG - Intergenic
1021794748 7:24242880-24242902 TTTTGTCCAGGTCTGGGGGAAGG + Intergenic
1022093392 7:27122910-27122932 TTTTGGCGGGGGAGTGGGGAAGG + Intronic
1022192194 7:28027118-28027140 TTTTCTCCAGGGATGGGAGAAGG - Intronic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022959997 7:35417520-35417542 TTGTATTAGGGGATGAGGGAAGG + Intergenic
1022960842 7:35424822-35424844 GGTTGTCAGGGGGTGGGAGAAGG + Intergenic
1023077468 7:36498366-36498388 TTGAGCCAGGGGATGGGGGATGG + Intergenic
1023450344 7:40277829-40277851 TGGGGTGAGGGGATGGGGGAGGG - Intronic
1023467641 7:40474637-40474659 GTTGGTCAGGGGATGTGGGATGG + Intronic
1023907032 7:44530365-44530387 TTGTGTCAGGGGCTGAGGGGAGG + Intronic
1023907329 7:44531886-44531908 ATTTGTGGGGAGATGGGGGACGG - Intronic
1024026832 7:45416991-45417013 GTTTGTCAGGGGCTGGGTGTAGG + Intergenic
1024177162 7:46852255-46852277 GGTTGCCAGGAGATGGGGGAAGG - Intergenic
1024790124 7:52956562-52956584 TAGTTTCAGGGGATGGGGAAGGG - Intergenic
1026234520 7:68514618-68514640 GGTTGCCAAGGGATGGGGGAAGG - Intergenic
1026337735 7:69409268-69409290 GTTTGCCAGGGGCTCGGGGAGGG + Intergenic
1026643464 7:72147943-72147965 TGTTGTGGGGGGAGGGGGGAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027288200 7:76672315-76672337 TTTTTTGAGGGGGTGAGGGATGG - Intergenic
1027430012 7:78102183-78102205 GGTTGTCAGGGGCTGGGGGTTGG + Intronic
1027753121 7:82177084-82177106 TTTTGGCGGGGGTTGGGGGGCGG + Intronic
1028039791 7:86037361-86037383 GCTTGTCAGGGGGTGGGGGAAGG - Intergenic
1028406801 7:90484246-90484268 TTATGCCAGTGGTTGGGGGATGG - Intronic
1028751882 7:94391953-94391975 TTTTTCCTGGGGATGGGGGTGGG - Intergenic
1028776820 7:94686936-94686958 TTTTGTCAAGGAATGGGAAAAGG + Intergenic
1028856563 7:95599794-95599816 TTTTTCCAGAGGGTGGGGGATGG + Intergenic
1028964969 7:96791905-96791927 AGTTGTCAGGGGTTGGAGGATGG + Intergenic
1028995125 7:97091531-97091553 GATTGTCAGGGGTTAGGGGAAGG - Intergenic
1029030193 7:97459038-97459060 TTTTGTTGGGGGGTGGGGGAGGG + Intergenic
1029139422 7:98400200-98400222 GCTGGTCAGGGGATGGGGGGTGG + Intronic
1029470980 7:100753982-100754004 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1029892852 7:103949536-103949558 TGTTGACAGGGGTTGGGGGGCGG - Intronic
1030063983 7:105645074-105645096 GGTTGCCAGGGGATGGGGAAGGG + Intronic
1030161572 7:106514576-106514598 AGTTGTCAGGGGCTGAGGGATGG - Intergenic
1030239215 7:107302354-107302376 GTTTGCCTGGGAATGGGGGAGGG + Intronic
1030457159 7:109790543-109790565 TTGAGTCAGTGGGTGGGGGAAGG - Intergenic
1030537993 7:110792853-110792875 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
1030606734 7:111645669-111645691 TTTTCTTAGGGGAAGGGAGATGG + Intergenic
1030629318 7:111878602-111878624 TACTGCCGGGGGATGGGGGAGGG - Intronic
1031216716 7:118901829-118901851 TTTAATTAGGGGATGTGGGAGGG - Intergenic
1031243877 7:119281705-119281727 TGCTGCCAGGGGATGGGGAAAGG + Intergenic
1031753251 7:125604964-125604986 TTTTTTCAGGGGATGAGAGTTGG - Intergenic
1031826050 7:126567070-126567092 TGTTGCCAGGGAATGGGGGCAGG + Intronic
1032001327 7:128267406-128267428 TTTTCCCAGGGGATGGGGGCGGG + Intergenic
1032138919 7:129308430-129308452 TGCTGCCAGGGGATGGGAGAGGG + Intronic
1032553615 7:132808876-132808898 TTTCGTGGGGGGAGGGGGGAGGG - Intronic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033381401 7:140823326-140823348 GCTTGCCAGGGGCTGGGGGAAGG - Intronic
1033432526 7:141301976-141301998 GGTTGCCAGGGGTTGGGGGAAGG + Intronic
1034397999 7:150842028-150842050 CACTGCCAGGGGATGGGGGAAGG - Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1035118660 7:156546679-156546701 TTTTGGCAGGGGGTGGGGCGGGG - Intergenic
1035176325 7:157054688-157054710 TGTTGGCAGGGTCTGGGGGAGGG - Intergenic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1035656756 8:1313771-1313793 TTATGTCTGGGGAGGGGAGAAGG + Intergenic
1035685464 8:1520595-1520617 GTTTGCCAGGGGTTGGGGGCAGG - Intronic
1035742938 8:1942915-1942937 GGTTGTCAGGGGCTGGGGAAGGG + Intronic
1035992510 8:4508638-4508660 TTTTTTCAGAGGGTGGGGGTTGG - Intronic
1036126149 8:6064566-6064588 TTTTTTGGGGGGATGTGGGAAGG - Intergenic
1036151798 8:6305891-6305913 GGTTGTCAGGGGCTGGGGGATGG - Intergenic
1036981093 8:13471130-13471152 AGTTGTCAGGGGTTGGGGGGAGG + Intronic
1037015817 8:13904812-13904834 TTTTCCCAGGAGATTGGGGAAGG - Intergenic
1037088347 8:14880803-14880825 TGGGGTCAGGGGATGGGGGTGGG + Intronic
1037412455 8:18613165-18613187 TTTCGTCAGGTGTTGGGGGCAGG - Intronic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1037938507 8:22931397-22931419 GGTTGTCAGGGGCTGGGGGTAGG - Intronic
1038515717 8:28186160-28186182 GGTTGTCAGGGGCTGGGAGAGGG + Intronic
1038597601 8:28903253-28903275 ATTTGTGAGGGGATCAGGGAGGG + Intronic
1038653121 8:29423611-29423633 TTTTGTGAGAGGTTGGGGGATGG + Intergenic
1038675956 8:29623126-29623148 TTTTTCCAGGGAATGGGGCAGGG + Intergenic
1038788603 8:30646349-30646371 TTTTTTGGGGGGATGGGGGGAGG - Intronic
1039421073 8:37441234-37441256 TGCTGCCTGGGGATGGGGGAGGG + Intergenic
1039866382 8:41507377-41507399 TTTGGTGGGGGAATGGGGGATGG + Intronic
1040437464 8:47405204-47405226 TGTGGTGGGGGGATGGGGGAGGG + Intronic
1040504103 8:48031458-48031480 TTTTGGCAGTGGCTGGGGGTAGG + Intronic
1040851265 8:51902381-51902403 TTTTTGCAGGGGGAGGGGGATGG - Intergenic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1041049386 8:53918242-53918264 GGTTGCCAGGGGATGGGGTAAGG - Intronic
1041495848 8:58484478-58484500 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1041823150 8:62062748-62062770 TGCTGCCAGGGGGTGGGGGAAGG - Intergenic
1041872426 8:62649823-62649845 ATTGGGCAGGGGCTGGGGGAAGG + Intronic
1042141167 8:65680158-65680180 TTTTCTCAGGGGTTGGGGGGCGG + Intronic
1042558050 8:70050514-70050536 ATTTGTCATGTGGTGGGGGAGGG + Intergenic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1042905712 8:73769669-73769691 GGTTGTCAGGGGTTGGGGTAGGG - Intronic
1043130066 8:76448600-76448622 TTGTCCCAGGGGATGGGGGGGGG - Intergenic
1043214871 8:77573595-77573617 TGCTGCCAGGGGATGGAGGAAGG - Intergenic
1043508149 8:80923062-80923084 TTTTTTCCGGGGGTGGGGGGGGG + Intergenic
1043639017 8:82425667-82425689 GGTTGTCAGGGGTTGGGGGAAGG - Intergenic
1043739688 8:83795149-83795171 GGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1043740301 8:83802274-83802296 TGTTGCCAGGAAATGGGGGAGGG + Intergenic
1044046926 8:87447726-87447748 ATTTATCAGGGCATGGGGGGCGG - Intronic
1044607849 8:94062588-94062610 TTTTGACAGGTTGTGGGGGAGGG - Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044764013 8:95552374-95552396 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1044866499 8:96576068-96576090 TTGTGTGTGGGGATCGGGGAGGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045171187 8:99670643-99670665 TGTTGCCAGGGGCTAGGGGAAGG - Intronic
1045383655 8:101650637-101650659 GGTTGCCAGGGGATGGGGGTAGG + Intronic
1045485092 8:102624893-102624915 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1045941299 8:107741417-107741439 TTTTGGCAGGGGATGGGAAGGGG + Intergenic
1046211495 8:111081737-111081759 TGTTGCCAGGGCATGAGGGAGGG + Intergenic
1046603400 8:116343765-116343787 CTTTGTCAGGGGATGGCTGATGG + Intergenic
1047093390 8:121597441-121597463 TTTTGACAGGTGTCGGGGGAGGG + Intergenic
1047214447 8:122865072-122865094 TGCTGTCAGGGGCTGGGGAAAGG + Intronic
1047372035 8:124264152-124264174 AATTGTTAGGGGCTGGGGGAAGG - Intergenic
1047530425 8:125669308-125669330 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1047777872 8:128088440-128088462 TTGGGGCAGGGGTTGGGGGATGG + Intergenic
1047922084 8:129645779-129645801 TTTTGCGGGGGGCTGGGGGAGGG - Intergenic
1048027460 8:130599912-130599934 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048435926 8:134417423-134417445 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1048707852 8:137174360-137174382 GTTTACCATGGGATGGGGGAAGG - Intergenic
1048714011 8:137246580-137246602 TAGGGTGAGGGGATGGGGGAGGG + Intergenic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049113692 8:140667096-140667118 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1049295376 8:141830984-141831006 TTTTGCCTGCGGCTGGGGGAGGG - Intergenic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049688600 8:143949191-143949213 ATTTGCCAGGGTGTGGGGGAGGG - Intronic
1050018332 9:1259326-1259348 ATTTGGTAGGGGATGAGGGAGGG - Intergenic
1050111634 9:2222836-2222858 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1050161465 9:2724018-2724040 TTTTGCCGGGGGTTGGGGGGTGG + Intronic
1050501377 9:6301361-6301383 TGGGGTGAGGGGATGGGGGAGGG + Intergenic
1050721829 9:8600042-8600064 TGCAGCCAGGGGATGGGGGAGGG - Intronic
1051182286 9:14424012-14424034 TTTTGGCAAGGGGTGGGGGCTGG + Intergenic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1051778229 9:20659219-20659241 TTTTGTGTGGGGCGGGGGGAGGG - Intronic
1051939057 9:22482440-22482462 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1052002684 9:23306000-23306022 TTTTTTCAGGGGATGGGTGGTGG + Intergenic
1052060402 9:23953788-23953810 TATTGTAATGGGTTGGGGGAAGG - Intergenic
1052335201 9:27312140-27312162 TTTGGGCAGGGGACGGGGGTGGG + Intergenic
1052450899 9:28629913-28629935 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1052624494 9:30957459-30957481 TGGTGTGGGGGGATGGGGGAGGG + Intergenic
1053187523 9:36030552-36030574 GTTTGCCTGGGGTTGGGGGAAGG - Intergenic
1053603749 9:39636217-39636239 GTTTGCCAGGGGTTGGGGGTAGG + Intergenic
1053620109 9:39806455-39806477 GGTTGTCAGGGGTTGAGGGAAGG + Intergenic
1053626588 9:39877487-39877509 GGTTGTCAGGGGTTGAGGGAAGG - Intergenic
1053861626 9:42392573-42392595 GTTTGCCAGGGGTTGGGGGTAGG + Intergenic
1053878281 9:42565757-42565779 GGTTGTCAGGGGTTGAGGGAAGG + Intergenic
1053894380 9:42728610-42728632 GGTTGTCAGGGGTTGAGGGAAGG - Intergenic
1054217299 9:62373216-62373238 GGTTGTCAGGGGTTGAGGGAAGG + Intergenic
1054233412 9:62535937-62535959 GGTTGTCAGGGGTTGAGGGAAGG - Intergenic
1054249791 9:62706202-62706224 GTTTGCCAGGGGTTGGGGGTAGG - Intergenic
1054264047 9:62900989-62901011 GGTTGTCAGGGGTTGAGGGAAGG - Intergenic
1054563901 9:66740724-66740746 GTTTGCCAGGGGTTGGGGGTAGG - Intergenic
1054754922 9:68947973-68947995 TTTTGTAAGGGCATGGGTGATGG - Intronic
1054831868 9:69634171-69634193 CGTTGCCAGGGGATGGAGGAGGG - Intronic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1055301969 9:74891729-74891751 TGTTGCCTGGGGATGGGGGAGGG - Intergenic
1055503557 9:76925839-76925861 TTTTTTGCGGGGAGGGGGGAGGG - Intergenic
1055536562 9:77252651-77252673 TGTTGTCAGGGGCTGGGTGCAGG - Intronic
1055849569 9:80610108-80610130 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1056034758 9:82592564-82592586 TTTGGTGGGGGGATGTGGGAGGG - Intergenic
1056161279 9:83896898-83896920 TTTTGCCAGGGGCTGAGGAAAGG + Intronic
1056177316 9:84048110-84048132 TTTTCTGGGGGGAGGGGGGAGGG + Intergenic
1056358852 9:85832353-85832375 TTTTGCCAGGGGCTGAGGAAAGG - Intergenic
1056593642 9:87986562-87986584 TGTTGTCAAGGACTGGGGGAAGG - Intergenic
1056622698 9:88227272-88227294 TTTTGGCAGGGGTTGGGGGTGGG - Intergenic
1057607806 9:96513479-96513501 TTTTGTCAGGGCAGATGGGAAGG - Intronic
1057728528 9:97587759-97587781 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
1058088831 9:100781141-100781163 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1058107275 9:100986845-100986867 TGGGGTCGGGGGATGGGGGAGGG + Intergenic
1058117590 9:101102286-101102308 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1058252669 9:102719900-102719922 TTTTTTCACGGGTTGGGGGGGGG - Intergenic
1058371644 9:104275899-104275921 TTCTGTCATGTGATGGAGGATGG - Intergenic
1058522931 9:105829503-105829525 TGTTGCCAGGTGATGGGAGAGGG + Intergenic
1058930758 9:109716632-109716654 TTTAGTCAGGGATAGGGGGAAGG + Intronic
1058972566 9:110096777-110096799 TTTTGTGGGGGGTTGGGGGGGGG + Intronic
1058998645 9:110325113-110325135 TTTTTTCGGGGGTGGGGGGATGG - Intronic
1059039552 9:110796966-110796988 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1059344373 9:113618187-113618209 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1059442004 9:114313217-114313239 ATTTTCCAGGGGTTGGGGGAGGG - Intergenic
1059680513 9:116581027-116581049 TTTTCCCTGGGGATGGGGGTGGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059708544 9:116846184-116846206 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1059992789 9:119881089-119881111 TCTTGCCTGGGGAAGGGGGATGG - Intergenic
1060249487 9:121973593-121973615 TGGGGTCAGGGGAGGGGGGAAGG + Intronic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060834650 9:126745963-126745985 TGATGCCAGGGGATGGGGGAAGG + Intergenic
1060953678 9:127622144-127622166 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1061089305 9:128418024-128418046 TTTGGCCAGGGGTTGGGGGGTGG - Intronic
1061102558 9:128503354-128503376 AGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1061421602 9:130475759-130475781 TTTGGTGGGGGGGTGGGGGACGG + Intronic
1061503349 9:131016232-131016254 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1061544364 9:131295665-131295687 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1061643566 9:131980072-131980094 ATTTCTTGGGGGATGGGGGAAGG + Intronic
1061782881 9:133006225-133006247 TTTTGGCGGGGGCGGGGGGAGGG - Intergenic
1061936684 9:133861719-133861741 TTTTGTCAGGGGCTGCCAGAGGG + Intronic
1062308913 9:135925378-135925400 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1062316678 9:135970703-135970725 TCCTGCCAGGTGATGGGGGAAGG - Intergenic
1062532147 9:137006729-137006751 TGTGGGCAGGAGATGGGGGAGGG - Intergenic
1203618246 Un_KI270749v1:89704-89726 TTGAGTCAGAGGAGGGGGGAGGG + Intergenic
1203635888 Un_KI270750v1:110631-110653 GGTTGCCAGGGGCTGGGGGAAGG + Intergenic
1185884728 X:3772357-3772379 TATTGCCAGGGGCTGAGGGAAGG - Intergenic
1186141879 X:6584156-6584178 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1186193900 X:7093165-7093187 GATTGCCAGGGGCTGGGGGAGGG - Intronic
1186250140 X:7656828-7656850 ACATGGCAGGGGATGGGGGAAGG + Intergenic
1186343492 X:8667305-8667327 TTTTGCGGGGGGATGGGGGTGGG + Intronic
1186356809 X:8799612-8799634 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1186357136 X:8800727-8800749 TGGGGTGAGGGGATGGGGGAAGG - Intronic
1186479659 X:9886606-9886628 GGTTGCCAGGGGGTGGGGGAGGG - Intronic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1186545270 X:10442551-10442573 TTTAGTCAGTGTATGGGGGTTGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187214903 X:17266676-17266698 TTGTGTCATGGGTTGGGGAAGGG + Intergenic
1187297258 X:18013786-18013808 TTTTGCCAGGGGAACGGGAAAGG - Intergenic
1187376055 X:18755713-18755735 TATTGCCAGGGGCTGGGGGAGGG - Intronic
1187627264 X:21129971-21129993 TTTTTTGGGGGGAGGGGGGAGGG - Intergenic
1187828316 X:23355025-23355047 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187960824 X:24564759-24564781 TGTTGCCAGTGGCTGGGGGAGGG - Intronic
1187975711 X:24702747-24702769 TTTTGGAAGGGGATGGATGAGGG + Intronic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1188824748 X:34818099-34818121 GCCTGTCAGGGGTTGGGGGAGGG - Intergenic
1188927480 X:36062686-36062708 TGTTTTCAGGGGCTGGGGGTGGG + Intronic
1188972364 X:36633257-36633279 TGTTGTCTGGGGTTGTGGGAGGG + Intergenic
1189272705 X:39762356-39762378 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1189287252 X:39860592-39860614 TTTCCACAGGGGCTGGGGGAGGG - Intergenic
1189305108 X:39980984-39981006 TTGTGTCATTGGCTGGGGGATGG + Intergenic
1189599660 X:42609563-42609585 GCCTGTCAGGGGATGGGGGAAGG + Intergenic
1189628034 X:42920676-42920698 TACTGCCAGGGTATGGGGGAGGG - Intergenic
1189791512 X:44609709-44609731 GGTTGCCAGGGGCTGGGGGATGG + Intergenic
1189802140 X:44701323-44701345 TGTTGTCAGGGCCTGGGGAAAGG - Intergenic
1189843894 X:45114157-45114179 TTTTGTGGGGGGAGGGGAGAGGG + Intergenic
1189863438 X:45297469-45297491 TCTGGTCATGGGATTGGGGATGG - Intergenic
1189869901 X:45370848-45370870 TACTGCCAGGGGATGGAGGATGG - Intergenic
1190014978 X:46819153-46819175 TACTGCCAGGGGATGGGGAAGGG - Intergenic
1190096583 X:47486074-47486096 TTTTTGCGGGGGGTGGGGGACGG - Intergenic
1190327617 X:49216340-49216362 GTTTATCAGGGGATGAGGCAGGG - Intronic
1190378418 X:49814105-49814127 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1190624214 X:52320785-52320807 TTTTTTATGGGGGTGGGGGAGGG + Intergenic
1190826852 X:54025681-54025703 TGTTGACAGGGTCTGGGGGATGG - Intronic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1191763214 X:64666214-64666236 TTTCTTCTTGGGATGGGGGAGGG - Intergenic
1191782549 X:64884516-64884538 GTCTGTCATGGGGTGGGGGAAGG + Intergenic
1192134934 X:68588469-68588491 TACTGCCAGGGGATGAGGGAGGG - Intergenic
1192351961 X:70363385-70363407 TGGGGTCAGGGGACGGGGGAGGG - Intronic
1192432107 X:71119320-71119342 TTTCCTTAGGGGAAGGGGGAAGG - Intronic
1192439928 X:71166867-71166889 TTTTGGCAGGGGATGATGTAGGG - Intronic
1192588685 X:72341290-72341312 ATGTGTCAGGGGATGAGGGTGGG + Intronic
1192777893 X:74264143-74264165 TGTTGCCAGGGGCCGGGGGAGGG - Intergenic
1192825083 X:74687471-74687493 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1192902080 X:75510717-75510739 TGGGGTCGGGGGATGGGGGAGGG - Intronic
1192907676 X:75568433-75568455 TTTTGTTAGAGGATGAGGGCTGG + Intergenic
1192918484 X:75680659-75680681 TGTGGTGGGGGGATGGGGGAGGG - Intergenic
1193136067 X:77972080-77972102 TGTTTTCAGGGGATGGGTTAGGG + Intronic
1193219781 X:78910516-78910538 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193596542 X:83452309-83452331 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1193704438 X:84804130-84804152 TGTGGTGGGGGGATGGGGGAGGG - Intergenic
1193816683 X:86113459-86113481 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1193940994 X:87680948-87680970 TAGTTTCAGGGGATGGGGAAGGG - Intergenic
1194252374 X:91591823-91591845 GCTTGTCAGGGGGTGGGGTAGGG + Intergenic
1194416356 X:93617275-93617297 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1194528351 X:95010057-95010079 GTTTGTTAGGGGTTGCGGGAAGG - Intergenic
1194555221 X:95350082-95350104 TTTTTTTGGGGGGTGGGGGAGGG - Intergenic
1194629131 X:96261714-96261736 TGTTGTGGGGGGAGGGGGGAGGG + Intergenic
1194688164 X:96950480-96950502 ATTTGTCAGTGGGTGGGGCAGGG - Intronic
1194754053 X:97716214-97716236 TGTTGTCAGGGGTTGGGGGATGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1194892604 X:99398595-99398617 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
1195090246 X:101451431-101451453 TGCTGCCAGGAGATGGGGGAAGG + Intronic
1195252394 X:103062030-103062052 TTGTGTCATGGGCTGGGGGCAGG + Intergenic
1195497786 X:105557743-105557765 TTTTGTCTCTGGATTGGGGAGGG - Intronic
1195501959 X:105612645-105612667 TGCTGTCAGGGGATGGGGGAGGG - Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195778992 X:108439912-108439934 TTTGGGGAGGGGAGGGGGGAAGG + Exonic
1196152054 X:112385780-112385802 GTTAGTCAGGGGTTGGGGAATGG + Intergenic
1196181207 X:112691939-112691961 TGTTGCCAGGGCCTGGGGGAAGG + Intergenic
1196466070 X:115972800-115972822 TACTGCCAGGGGTTGGGGGAGGG - Intergenic
1196495292 X:116317723-116317745 TTTTGTCTGGGCCTGGGGGAGGG - Intergenic
1196589466 X:117469259-117469281 CGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1196916856 X:120545856-120545878 TATTGGCAGGGGGTGGGGGTGGG + Intronic
1197104201 X:122694399-122694421 TGGGGTCGGGGGATGGGGGAGGG - Intergenic
1197249852 X:124204215-124204237 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1197575635 X:128207867-128207889 TAGTTTCAGGGGATGGGGAAGGG - Intergenic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198394958 X:136211621-136211643 TTTGGCCAGGGGATTAGGGAGGG + Intergenic
1198563215 X:137874743-137874765 GTTTGCTAGGGGCTGGGGGAAGG + Intergenic
1198663291 X:138995108-138995130 CATTGCTAGGGGATGGGGGAGGG - Intronic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1198830999 X:140750248-140750270 GTTTGCCAGGGGCTGGGGTAAGG + Intergenic
1198980871 X:142394450-142394472 TTACGTTGGGGGATGGGGGAGGG - Intergenic
1199142237 X:144326599-144326621 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1199181810 X:144866295-144866317 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1199314826 X:146364171-146364193 CACTGTGAGGGGATGGGGGAGGG + Intergenic
1199393161 X:147305694-147305716 TGTTGCTGGGGGATGGGGGAGGG - Intergenic
1199415097 X:147573368-147573390 TGCTGCCAGGGGATTGGGGAAGG - Intergenic
1199495198 X:148444996-148445018 GGTTGTCAGAGGCTGGGGGAGGG + Intergenic
1199620963 X:149700706-149700728 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1199786618 X:151112013-151112035 TTGTGGCATGGGATGGGGGCAGG + Intergenic
1199876379 X:151932185-151932207 TTAGGTCAGGGGATGGGGTGGGG - Intergenic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200368941 X:155700753-155700775 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1200571304 Y:4833064-4833086 GCTTGTCAGGGGGTGGGGTAGGG + Intergenic
1200883439 Y:8244526-8244548 GCTTGTCATGGGATGGGGGGAGG + Intergenic
1201261293 Y:12161346-12161368 TTTTGTGGGGTGATGGGGGTGGG + Intergenic
1201338476 Y:12905294-12905316 GTTTGTGAGGGGGCGGGGGAGGG + Intronic
1201565859 Y:15364844-15364866 GATTGCCAGGGGCTGGGGGAGGG - Intergenic
1201644054 Y:16208032-16208054 TAGTTTCAGGGGATGGGGAAGGG + Intergenic
1201658761 Y:16377289-16377311 TAGTTTCAGGGGATGGGGAAGGG - Intergenic
1201703283 Y:16907607-16907629 TGGGGTTAGGGGATGGGGGAGGG + Intergenic
1201746053 Y:17375202-17375224 TGGGGTCAGGGGATGGGGGAGGG - Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic
1202348134 Y:23957013-23957035 TGGTGTCGGGGGAGGGGGGAGGG - Intergenic
1202522640 Y:25713091-25713113 TGGTGTCGGGGGAGGGGGGAGGG + Intergenic
1202594686 Y:26524454-26524476 TTTGGTAGGGGGAGGGGGGAGGG + Intergenic