ID: 903649162

View in Genome Browser
Species Human (GRCh38)
Location 1:24912544-24912566
Sequence CCTTTAAAGCAGTCGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903649153_903649162 18 Left 903649153 1:24912503-24912525 CCACAGTAGATCCCCATCACACC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649149_903649162 27 Left 903649149 1:24912494-24912516 CCCCTTCTCCCACAGTAGATCCC 0: 1
1: 0
2: 2
3: 15
4: 213
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649148_903649162 28 Left 903649148 1:24912493-24912515 CCCCCTTCTCCCACAGTAGATCC 0: 1
1: 0
2: 1
3: 15
4: 263
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649155_903649162 7 Left 903649155 1:24912514-24912536 CCCCATCACACCTCTGCAGGCTA 0: 1
1: 0
2: 0
3: 9
4: 236
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649152_903649162 19 Left 903649152 1:24912502-24912524 CCCACAGTAGATCCCCATCACAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649160_903649162 -3 Left 903649160 1:24912524-24912546 CCTCTGCAGGCTAGGGCTGTCCT 0: 1
1: 0
2: 0
3: 18
4: 202
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649157_903649162 5 Left 903649157 1:24912516-24912538 CCATCACACCTCTGCAGGCTAGG 0: 1
1: 0
2: 0
3: 20
4: 229
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649156_903649162 6 Left 903649156 1:24912515-24912537 CCCATCACACCTCTGCAGGCTAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649150_903649162 26 Left 903649150 1:24912495-24912517 CCCTTCTCCCACAGTAGATCCCC 0: 1
1: 0
2: 0
3: 8
4: 176
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649151_903649162 25 Left 903649151 1:24912496-24912518 CCTTCTCCCACAGTAGATCCCCA 0: 1
1: 0
2: 2
3: 17
4: 187
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
903649147_903649162 29 Left 903649147 1:24912492-24912514 CCCCCCTTCTCCCACAGTAGATC 0: 1
1: 0
2: 1
3: 29
4: 211
Right 903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903649162 Original CRISPR CCTTTAAAGCAGTCGCCAGC AGG Intronic
902793346 1:18784180-18784202 CCTTTAAGGCAGGCCCCAGCTGG + Intergenic
903122241 1:21223892-21223914 CCTTTAAAACAGGGGTCAGCCGG - Intronic
903649162 1:24912544-24912566 CCTTTAAAGCAGTCGCCAGCAGG + Intronic
904166643 1:28560637-28560659 TCTACAAAGCAGTAGCCAGCTGG - Exonic
909475325 1:76075091-76075113 CCTTCAATGCAGGCGCGAGCAGG - Intronic
912439192 1:109685966-109685988 CCTTTAAAGCAGTCAACCCCAGG + Intronic
913476365 1:119242138-119242160 CATTTAAAGTAGTAGCCACCAGG - Intergenic
1065791752 10:29266793-29266815 TCTTGAAAGCAGCCACCAGCAGG + Intergenic
1067052369 10:43029291-43029313 CCTTTCAAGCTTTCCCCAGCAGG + Intergenic
1068318654 10:55381414-55381436 TCTTTAAAGCAGTTGACATCAGG - Intronic
1072812117 10:98470057-98470079 CCTTTACAGCAGTCTACAGGTGG + Intronic
1076895240 10:133308443-133308465 CCTCTAAACCAGTCGCGAACTGG - Intronic
1077161050 11:1113071-1113093 CCTTTAAAGCAGAGGCTACCCGG + Intergenic
1080005298 11:27399813-27399835 TTTTTAAAACAGTTGCCAGCCGG - Intronic
1086327634 11:85720109-85720131 CCATTAAAGCAGCTGCCAGTGGG + Intronic
1087158516 11:94927028-94927050 CCTTTAAACAAGGAGCCAGCTGG - Intergenic
1092856614 12:12680418-12680440 CCTTTAAAGCAGTCATCTCCTGG - Intronic
1096805272 12:54137037-54137059 CCTTCAAAACAGTCACCTGCAGG + Intergenic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1112561752 13:100521395-100521417 CCATTAAAGGAGTCTTCAGCCGG + Intronic
1113314139 13:109160732-109160754 GCCTTCAAGCAGTGGCCAGCAGG - Intronic
1123508287 15:20968440-20968462 ACCTTAAAGCAGTCACCACCTGG - Intergenic
1123565508 15:21542189-21542211 ACCTTAAAGCAGTCACCACCTGG - Intergenic
1123601772 15:21979478-21979500 ACCTTAAAGCAGTCACCACCTGG - Intergenic
1127704889 15:61536791-61536813 CCTTTAAATCAGACTACAGCAGG + Intergenic
1128245323 15:66128759-66128781 CCTTTAAAGCAGTCCAGATCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1202973881 15_KI270727v1_random:269283-269305 ACCTTAAAGCAGTCACCACCTGG - Intergenic
1134242179 16:12514114-12514136 TCTTTCAAGCATTAGCCAGCTGG - Intronic
1137421990 16:48342760-48342782 ACTTTAAAGAAGTTGCCAGATGG + Intronic
1137852872 16:51763606-51763628 CCCTGAAAGCACTCACCAGCCGG - Intergenic
1140358510 16:74325560-74325582 CCTTTACAGCAAAGGCCAGCAGG + Intergenic
1144662173 17:17078227-17078249 TTTTTAAAGCTGTCTCCAGCAGG - Intronic
1148220970 17:45861485-45861507 CATGTATAGCAGTCCCCAGCTGG - Intergenic
1157828051 18:50830551-50830573 CCCTTAAAGAAGTTGCAAGCTGG + Intergenic
1162500291 19:11049587-11049609 TCTTTATAGCAGTCAGCAGCTGG + Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
925622977 2:5812251-5812273 CTTTTAAAGCTGTTCCCAGCTGG + Intergenic
944934039 2:204548851-204548873 TCTTTATAGCACTCGCCACCTGG - Intronic
1170077513 20:12435822-12435844 TCTTTATAGCAGTCGGCAGGAGG - Intergenic
1171003023 20:21433878-21433900 CCCTTCAAGCAGAAGCCAGCTGG + Intergenic
1175549430 20:59807474-59807496 ACTGTAAAGCAGCCTCCAGCAGG - Intronic
1175778645 20:61668563-61668585 CCTGGACAGCAGTGGCCAGCAGG - Intronic
1176418183 21:6491899-6491921 CCTTTAAAACAGTCTAGAGCTGG - Intergenic
1178799454 21:35778957-35778979 CCTTAAAAGCACTAGCCAGAAGG + Intronic
1179389217 21:40972281-40972303 CCTCTAAATCAGTCTCCAGGGGG - Intergenic
1179693676 21:43100221-43100243 CCTTTAAAACAGTCTAGAGCTGG - Intronic
1179799030 21:43802307-43802329 CCCTTCAAGCAGGCGCCTGCAGG - Exonic
1183832677 22:40426797-40426819 CCATTACAGCAGCTGCCAGCTGG + Intronic
1184427601 22:44422243-44422265 CCTTGGAAGCAGTGGGCAGCAGG - Intergenic
950710130 3:14808035-14808057 CCTCTAAGGCAGATGCCAGCAGG - Intergenic
958041541 3:88231773-88231795 ACTTTAAAGCAATCACAAGCAGG - Intergenic
961009359 3:123425603-123425625 CCTCTAGAGCAGTCCCCAGAAGG + Intronic
965030110 3:163354882-163354904 CATTTAAAGCAGTGGGCAGAGGG - Intergenic
968841794 4:3012580-3012602 CTTTTAAAGCAGTCCCCTGTGGG + Intronic
971276944 4:25207542-25207564 CCTGTTAAGCAGTAGCCATCAGG + Intronic
985193031 4:187398338-187398360 CTTTTAAAGAAGTCACCATCTGG - Intergenic
988866181 5:35337725-35337747 CCTTTCAACCAGTTGCCATCAGG - Intergenic
988885289 5:35550572-35550594 TCTTCAAACCAGTCTCCAGCAGG + Intergenic
996521054 5:124426126-124426148 CATTTAAAGCAGTGGGCAGAGGG + Intergenic
996796490 5:127353673-127353695 CCTTTACAGCAGTATCCAGCAGG - Intronic
998147965 5:139740857-139740879 CCTCTGAAGCAGACCCCAGCCGG - Intergenic
1006095356 6:31652778-31652800 CCTGAAAAACAGTCACCAGCTGG + Intronic
1008692767 6:53999504-53999526 CCTGGAAAGGAGTTGCCAGCTGG + Intronic
1015747037 6:136521099-136521121 TCTTCAAAGCAGTCATCAGCTGG - Intronic
1017235998 6:152118309-152118331 CATTAAAAGCAGTCACCAGTGGG - Intronic
1021959467 7:25857862-25857884 CCTTTTCAGCAGGCGCCTGCGGG + Intergenic
1025215000 7:57049028-57049050 ACTTTAAAGAATTCACCAGCCGG - Intergenic
1025656952 7:63527789-63527811 ACTTTAAAGAATTCACCAGCCGG + Intergenic
1027978088 7:85184896-85184918 GGGTTAAAGCAGTGGCCAGCTGG + Intronic
1028000905 7:85496934-85496956 CCTTAAAAGCAGGCCCCAGTTGG - Intergenic
1029684681 7:102138697-102138719 ACTTTAAAGAATTCACCAGCAGG - Intronic
1034423585 7:151001599-151001621 CCTTTAAAGAAGTGGCCAAGTGG + Exonic
1034957777 7:155345115-155345137 CCTTGAAGTCAGTCGCCGGCAGG - Intergenic
1035334822 7:158121120-158121142 CCTTTGGAGCAGTCACCACCAGG - Intronic
1039614205 8:38942103-38942125 CCGTTAAAGTAGCAGCCAGCCGG + Intronic
1042904653 8:73760572-73760594 GCTTTAAAGCAGAGGTCAGCCGG + Intronic
1045705745 8:104920553-104920575 ATTCTAAAGCAGTCGCCAACTGG - Intronic
1047602234 8:126437393-126437415 TTTTCAAAGCAGTGGCCAGCAGG + Intergenic
1049173006 8:141173749-141173771 CCTTTCAAGCAGCGACCAGCAGG + Intronic
1051124460 9:13788426-13788448 CCTTTAAAATAGTCACCAGAAGG + Intergenic
1058447223 9:105064722-105064744 ACTTCAAAGCCGTTGCCAGCTGG - Intergenic
1190908433 X:54750510-54750532 CCTTCATAGCAGTCTCCAGAGGG + Intronic
1201422009 Y:13809867-13809889 CATTTAAAGCAGTGTGCAGCGGG - Intergenic
1202174915 Y:22089009-22089031 CATTTAAAGCAGTGGGCAGAGGG + Intronic
1202216447 Y:22497373-22497395 CATTTAAAGCAGTGGGCAGAGGG - Intronic
1202326740 Y:23698696-23698718 CATTTAAAGCAGTCGGCAGAGGG + Intergenic
1202544029 Y:25971357-25971379 CATTTAAAGCAGTCGGCAGAGGG - Intergenic