ID: 903651711

View in Genome Browser
Species Human (GRCh38)
Location 1:24926692-24926714
Sequence CTGTGGAGTTGGGGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 551}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903651705_903651711 -10 Left 903651705 1:24926679-24926701 CCACTTCAGCCTGCTGTGGAGTT 0: 1
1: 0
2: 11
3: 195
4: 3607
Right 903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG 0: 1
1: 0
2: 3
3: 59
4: 551
903651702_903651711 28 Left 903651702 1:24926641-24926663 CCTGTTTATTGGTGATGAAAAGC 0: 1
1: 0
2: 0
3: 21
4: 183
Right 903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG 0: 1
1: 0
2: 3
3: 59
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903651711 Original CRISPR CTGTGGAGTTGGGGAGCAGA GGG Intronic
900183839 1:1324096-1324118 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900183880 1:1324192-1324214 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900459911 1:2798110-2798132 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459941 1:2798199-2798221 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459977 1:2798295-2798317 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460024 1:2798439-2798461 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460066 1:2798575-2798597 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460101 1:2798679-2798701 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900682319 1:3923863-3923885 GTGAGGAGTGGGGGAGCAGAAGG - Intergenic
900712923 1:4126021-4126043 GTATGTAGTTGGGGAACAGAGGG + Intergenic
901012790 1:6210694-6210716 CTGTGGATTTGGGGATGGGATGG + Intronic
901219368 1:7574397-7574419 CTGTGGTGTTGGGGAACACGTGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902421360 1:16283007-16283029 CTCAGGAGTTGGGGATAAGATGG - Intronic
902450038 1:16491092-16491114 ATGTGGGGATGGGGAGCTGATGG + Intergenic
902851786 1:19164252-19164274 CTGTGGATTGGCTGAGCAGATGG - Exonic
902979079 1:20110208-20110230 CTGAGGGGTTGGGTAGCTGATGG - Intergenic
903442206 1:23396492-23396514 GTGAGAAGTTGGGGAGCAGGGGG + Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903818064 1:26079547-26079569 CTGTGGGGGTGGGGAGCGGCAGG - Intergenic
903830380 1:26170804-26170826 CTCTGGGTTTGGGGAGCGGAGGG + Exonic
904043147 1:27595591-27595613 CTGTGGTTTTGGGGAGGAGCTGG + Intronic
904207273 1:28863363-28863385 ATGTGGAGTGGGGCAGTAGAAGG + Exonic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905304939 1:37011079-37011101 CTCTGGAGTTGGAAAGCACATGG - Intronic
906458607 1:46020115-46020137 CAGTGGAGTTGGGAAGCATGAGG + Intronic
906732827 1:48097951-48097973 GTGTGAAGTTTAGGAGCAGAGGG - Intergenic
906776862 1:48537577-48537599 ATGGGGACTTAGGGAGCAGAAGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907354911 1:53864150-53864172 CTGAGAAGTTGGTGAGGAGAAGG - Intronic
907401810 1:54229063-54229085 GTGTGGAGTTGGGTGGCAGTGGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908658799 1:66416537-66416559 GTGAGGAGGTGGGGAGAAGAGGG - Intergenic
910270649 1:85390539-85390561 CTTTGGGGTTGGGGAACACATGG + Intronic
910494032 1:87806065-87806087 CTGCCGAGTTGGGGAGGAAAAGG + Intergenic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911067984 1:93809155-93809177 CTTTGAAGTTGAGGAGGAGATGG + Intronic
911139977 1:94489496-94489518 CTGTTGAGTTGGGGATCCTATGG + Intronic
912638357 1:111320102-111320124 GTGTGGAGGTGGGGTGCAGTTGG - Intronic
913611242 1:120511700-120511722 CTGGGGAGTTGGCAAGCTGATGG + Intergenic
913983548 1:143545122-143545144 CTGGGGAGTTGGCAAGCTGATGG - Intergenic
914579949 1:149010539-149010561 CTGGGGAGTTGGCAAGCTGATGG - Exonic
914680653 1:149936267-149936289 CTGGGGAGTTGGGGAGCCTAGGG - Intronic
915420931 1:155780954-155780976 CTGTGGGTTTGGGCAGCACAGGG + Intronic
916206404 1:162319781-162319803 CTCTGGACTTGGGGTGCTGAGGG + Intronic
916435063 1:164770392-164770414 CTGAGGAGTTGGAGCACAGAAGG - Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916882225 1:169030365-169030387 CTGTGGAATTGGGGAGATGTTGG + Intergenic
917451314 1:175150062-175150084 CTGTGGTGTGGGGGAGCCGCCGG + Intergenic
917720163 1:177779640-177779662 CAGAGGAGTTGGGCAGCAGGAGG - Intergenic
917876913 1:179294084-179294106 CAGGGGAGTTGGGGAGGGGAGGG + Intronic
918040200 1:180909330-180909352 CTGGGGAGTTGGGGAGGGGCAGG - Intergenic
918893156 1:190302056-190302078 CTGTGGAGTTTGGGAGTATGTGG - Intronic
919830324 1:201536394-201536416 CTGTGGAGGAGGGGAACAGAGGG + Intergenic
919839358 1:201597865-201597887 CAATGGAGTTGGGCAGGAGATGG - Intergenic
920523722 1:206649444-206649466 CTGTGGGGTGGGGGAGCACCAGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921051481 1:211514928-211514950 CTCTGGAGTTGGGCAGCAATGGG + Intergenic
921134400 1:212247348-212247370 GTGTGGAGGTGAGGAGCGGAGGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922448744 1:225719498-225719520 CTGTGGACTTGGTGGGCACACGG - Intergenic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
923092648 1:230751848-230751870 CTGTGGGGTGGGGGAGGGGAGGG + Intronic
923147408 1:231207860-231207882 CTGGGGGGTTGGGGAGCAAAAGG + Intronic
923196313 1:231671532-231671554 GTGTTGAGCTGGGGAGAAGAAGG - Intronic
923334092 1:232951758-232951780 TGGGGGAGTTGGGGAGCAGGGGG + Intronic
923875810 1:238045769-238045791 TTGGGGACTTGGGGAGAAGAGGG + Intergenic
1063427237 10:5960005-5960027 CTGTGGAATGGAGGAGCTGAGGG - Intronic
1063555511 10:7075273-7075295 CTGAGGAGGTGTGGAGCAGGTGG + Intergenic
1064003327 10:11681502-11681524 CTCTGAAGTTGGGGAGCAGTGGG - Intergenic
1064731253 10:18332976-18332998 CTATGGGGTTGGGGAGTAAAGGG + Intronic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1066047226 10:31604188-31604210 CTGTGGACTCGGGGAGGGGAGGG - Intergenic
1066065740 10:31759813-31759835 AGGTGGATTTGGGGAGCAGGTGG + Intergenic
1067529345 10:47059185-47059207 CTGTGGACTTCGGGAGCTGGAGG + Intergenic
1067842207 10:49690043-49690065 CTCTGGACTTGGTGAGCTGAAGG + Intronic
1067926692 10:50515675-50515697 CTGGGGAGCTGGGGAGGTGATGG - Intronic
1068229265 10:54149925-54149947 GTGTGGAGTTGGGGAGGAAGAGG + Intronic
1069245010 10:66193343-66193365 CTGTGGTGTTGTGGAGCAAGTGG + Intronic
1069713870 10:70508404-70508426 CATGGGAGTTGGGGAGCAGCAGG + Intronic
1069821884 10:71233525-71233547 CCGTGGAGTGGGGAGGCAGAGGG - Intronic
1069898192 10:71691863-71691885 CTGGAGGCTTGGGGAGCAGATGG + Intronic
1070307602 10:75248865-75248887 CTGTGGAGGTTTGGAGGAGAAGG - Intergenic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070877167 10:79825715-79825737 CTGGGGAGTTGGGGAGACGATGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071468973 10:85965923-85965945 CTCTGGAGCTGGGGAGGAGGTGG - Intronic
1071515508 10:86294258-86294280 CTGAGGCCTGGGGGAGCAGATGG + Intronic
1071643662 10:87341759-87341781 CTGGGGATTTGGGGAGACGATGG + Intergenic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072780887 10:98250977-98250999 CGCTGGAGTGTGGGAGCAGAGGG + Intronic
1073848327 10:107585486-107585508 CTGTGGAGAGGGGGCCCAGAAGG + Intergenic
1073867593 10:107822741-107822763 CTGTGGACTTTGTGAGCAGTGGG - Intergenic
1074120798 10:110493294-110493316 CTGAGGAGCTGGGGAGGAGCTGG + Intergenic
1074721879 10:116271645-116271667 AGGTGGAGTTGGGGAGCATTGGG - Intronic
1074726541 10:116315935-116315957 CAGTGGAATTGGGGCACAGATGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075092720 10:119452581-119452603 TTGGGGTTTTGGGGAGCAGAAGG - Intronic
1075376723 10:121984012-121984034 CTGAGTAGCAGGGGAGCAGATGG - Intergenic
1075585209 10:123652354-123652376 ACATGGAGTTGGGGAGAAGATGG + Intergenic
1075872041 10:125778099-125778121 CAGTGCAGTTGGGGGTCAGAGGG - Intergenic
1076206734 10:128609960-128609982 CTGGGGTGTGGGGGTGCAGAAGG - Intergenic
1076460757 10:130644529-130644551 GTGAGGAGTTGGGGAGCAATGGG + Intergenic
1076464056 10:130666382-130666404 CTGCAGAGTTGGGGTGCAGAGGG + Intergenic
1076751359 10:132545116-132545138 GTGTGGAGTTGTGGGGCAGGTGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077303625 11:1858217-1858239 CTGTGGGGTTCGGGTGCTGAGGG + Intronic
1078616123 11:12867821-12867843 CTGGGTGGGTGGGGAGCAGAGGG + Intronic
1078779348 11:14422376-14422398 CTGTGGGGTGGGGGAGGAGGGGG - Intergenic
1079068553 11:17321233-17321255 GTGTGGAGTTGGGGAGTGGTGGG - Intronic
1079807898 11:24957895-24957917 TTGTGGGGTTGGGGAGGGGAGGG - Intronic
1080805399 11:35648455-35648477 CTGGGGAGTTGGTTACCAGAAGG + Intergenic
1080822027 11:35816495-35816517 GTGTGTAATTGGGGAACAGAAGG + Exonic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1082028398 11:47588473-47588495 CTGGGGGGTTGAGGAGGAGATGG - Exonic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1083733897 11:64668824-64668846 CTGCTGAGTTGGGGGCCAGAGGG - Intronic
1083740920 11:64711487-64711509 CTGTGGTGTCGGGGGGCAGGGGG - Intronic
1083831437 11:65236363-65236385 CTGAGGAGGAGGGGAGGAGAGGG - Intergenic
1083909468 11:65697597-65697619 CTCTGGAGTTTGGGAGGAGGTGG - Intergenic
1084138637 11:67207812-67207834 CTGAGGAGTTTGAGAGCAGCCGG + Intronic
1084674408 11:70625717-70625739 CAGGGGACTTGGGGAGCGGAGGG - Intronic
1084712755 11:70854097-70854119 TTGGGGAGTGGGGGAGAAGAAGG + Intronic
1085297865 11:75441143-75441165 ATGGTGAGTTGGGGGGCAGAGGG - Exonic
1085553745 11:77400487-77400509 CAGTGCAGATGGGTAGCAGATGG - Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1088551949 11:111022159-111022181 CTGTGCACTTGGAAAGCAGATGG - Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1090274211 11:125408396-125408418 CTGTGACCTTGGGGAACAGAGGG - Intronic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1090923737 11:131231435-131231457 CTGAGGTTTTGGGGAGCTGAAGG - Intergenic
1091408153 12:221596-221618 CTGGGGAGCGGGGGAGCTGAGGG - Intronic
1091498444 12:991670-991692 CTGGGCACTTGGGGAGCGGAGGG + Intronic
1091696293 12:2630424-2630446 CTGGGGACTTGGGGACCAGCAGG + Intronic
1092236533 12:6814251-6814273 CTGTGAAGTGGAGGACCAGAAGG + Exonic
1094540858 12:31362400-31362422 CTCAGGAGTTGGGGAGGACACGG + Intergenic
1094701559 12:32875329-32875351 GTGTGGAGTGGGGGAAAAGAAGG + Intronic
1095368967 12:41443280-41443302 TTGGGGAGTGGGGGAGAAGAAGG + Intronic
1096086818 12:48870818-48870840 CTGTGGGGTTGAGGAGGAAATGG + Intergenic
1097178376 12:57156606-57156628 CTGGGTTGTTGGGGGGCAGAGGG + Intronic
1097242664 12:57586440-57586462 CGGTGAAGGTGGGGAGCAGGAGG - Exonic
1097350961 12:58548531-58548553 CTTGGGACTTGGGGAACAGAAGG + Intronic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1099994629 12:89764795-89764817 CTGTCGTGGTGGGGAGCAGGTGG + Intergenic
1103182037 12:118921364-118921386 CTGTTGAGTTGAGGAGCAAGAGG - Intergenic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1103636353 12:122309786-122309808 CTGAGGAGCTGGGGAGAAGCAGG - Exonic
1103993265 12:124813264-124813286 GTGGGGCTTTGGGGAGCAGATGG - Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105654626 13:22422952-22422974 GTGGGGCGTGGGGGAGCAGAGGG - Intergenic
1106103319 13:26713097-26713119 ATGTAGAGTTGGGCAGCAGTGGG + Intergenic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1107028776 13:35830036-35830058 CTGTGGGGTAGAGGAGGAGAAGG + Intronic
1108255906 13:48611129-48611151 CTGTGGAGTTGGTGGCCACAAGG - Intergenic
1108506614 13:51118186-51118208 TTGTGGAGTTAGGAAGGAGAAGG + Intergenic
1108624168 13:52211168-52211190 GTGTGGTGTGGGGGAGAAGATGG - Intergenic
1110915133 13:81011932-81011954 CTGTGGTGTTGGTTACCAGAAGG - Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111965322 13:94856296-94856318 CTGTAGAGTTGGGGAGTATGTGG - Intergenic
1112358970 13:98699293-98699315 ATGTGGAGAAGGGGAACAGAGGG - Intronic
1112508914 13:99991414-99991436 CGGTGGCCCTGGGGAGCAGAAGG + Intergenic
1113090624 13:106614198-106614220 ATTTGGAGTTGGGGACCATAAGG + Intergenic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1113661984 13:112113983-112114005 CTGTTGAGTATGTGAGCAGAGGG + Intergenic
1113876533 13:113598147-113598169 CTGGGGTGGTGGGGAGTAGAGGG - Intronic
1113885816 13:113657941-113657963 CTCAGGAGGAGGGGAGCAGAGGG - Intronic
1114083489 14:19220435-19220457 CTGTGGGCTGGGGGAGCAGCTGG + Intergenic
1114461042 14:22886441-22886463 CTGTGGAGGTGCGAAGGAGAGGG - Intronic
1114533383 14:23408918-23408940 CTGAAGACTTGGGGAACAGAAGG - Intergenic
1114547257 14:23512177-23512199 CTGGGGAGCTGGGGTGCAGGGGG + Intergenic
1117340326 14:54786567-54786589 CTGTCGAGCAGGGGAGCACAGGG - Intronic
1118882949 14:69843972-69843994 CAGTGGAGCTGGGGAAGAGAAGG + Intergenic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119541281 14:75439786-75439808 CTGGGAAGGTGAGGAGCAGAGGG - Intronic
1119855853 14:77900226-77900248 CTGTGGAAGTGGGCATCAGAAGG + Intronic
1121167848 14:91824532-91824554 GTGTGGATTTTGGGAGCAGAAGG - Intronic
1121225722 14:92320495-92320517 CTGTGGGGTTGGGGAGGGGGCGG + Intergenic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1121465808 14:94114926-94114948 AGGTGGACTTGGGGAGCAGCTGG + Intronic
1121931453 14:97976261-97976283 TTTCGGAGTTGGGGTGCAGAAGG + Intronic
1122454489 14:101839457-101839479 CTGTGGAGTAGGGGCACAGATGG - Intronic
1122567498 14:102671251-102671273 CTGTGGAGTCGAGGGGAAGAGGG - Intronic
1122692659 14:103538550-103538572 GTGTGGAGTGGGGGAGTGGACGG + Intergenic
1123096503 14:105769426-105769448 CCGTGGAGTGGGAGAGCAGCGGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1124370850 15:29103886-29103908 CTGCGGAGTTGGCGAGCTGATGG - Intronic
1125592752 15:40865010-40865032 CTGGGGAGTGAGGGAGCAGGAGG - Intergenic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126848066 15:52779933-52779955 ATGTGGAGCTGGGGAGGAAAAGG + Intronic
1127250855 15:57236200-57236222 CTGGGAAGTGGGGAAGCAGATGG - Intronic
1127338351 15:58013449-58013471 GTTTGGATTTGGGGATCAGATGG - Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127665675 15:61144419-61144441 CTGTGCATGTGGGTAGCAGAAGG - Intronic
1128259442 15:66222302-66222324 CAGTATAGTTGGGGAGCAGCTGG - Intronic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129323855 15:74789343-74789365 CTGTGCAGTGGGGGTGCTGAGGG + Intronic
1129656113 15:77526751-77526773 CTGGGGGGTTCGGGAGGAGAGGG + Intergenic
1129742016 15:77993879-77993901 ATGTTGAGTTGGGGAGCAGCAGG - Intronic
1129843476 15:78757617-78757639 ATGTTGAATTGGGGAGCAGCAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130255303 15:82323270-82323292 CTGAGGAGTATGGGAGGAGACGG - Intergenic
1130596598 15:85253768-85253790 ATGTTGAGTTGAGGAGCAGCAGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1134249044 16:12561684-12561706 CTGGGGAGTTGGGGAAAAGGGGG - Intronic
1135553550 16:23416938-23416960 CTGGGGAACTGGGGACCAGACGG - Intronic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1137519488 16:49179923-49179945 CTGGGAAGCTAGGGAGCAGAGGG - Intergenic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141764831 16:86051529-86051551 CTGAGGACTTGGGGGCCAGAGGG + Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142143885 16:88484639-88484661 TTGTGGAGTATGGGTGCAGAGGG + Intronic
1142831552 17:2552885-2552907 GTAGGGAGTTGGGGAGCAGAAGG + Intergenic
1143115800 17:4581391-4581413 ATGTGGACCTGGGGTGCAGAGGG + Intergenic
1143426371 17:6842400-6842422 GTGTGGAGTTGGTCAGCGGAGGG - Intergenic
1143482189 17:7234217-7234239 CGGTGGGGTTGGGGAGACGAAGG - Exonic
1144462328 17:15468181-15468203 CAATGGAGTTGGGGAGAAGGAGG - Intronic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1146008282 17:29176112-29176134 CTGGAGAGTAGGGGAGAAGAAGG + Intronic
1146929893 17:36769410-36769432 CTGAGAAGTCGGGGAGGAGAGGG - Intergenic
1147047454 17:37764506-37764528 CTGTGGAGGTTGGAAGCAGTGGG + Intergenic
1147375101 17:40018529-40018551 CTGAGGAGCTGAGGAGGAGAAGG - Intergenic
1147438746 17:40433845-40433867 CTCTGGAGGTGGGGAGCGGGAGG + Intergenic
1147782855 17:42956166-42956188 CTGTGGAGTGGCTGAGAAGAGGG - Intronic
1148162052 17:45455848-45455870 CTGTGGAGTTTTGGGGCAGAGGG - Intronic
1148563815 17:48621430-48621452 CTGAGAAGTAGGGGAGCAGGGGG + Exonic
1148619719 17:49025496-49025518 CTATGGTGTTGGTGAGCAGAAGG + Intronic
1150206496 17:63412516-63412538 CTGTGGGCTTGGGGAGCAGCTGG - Intronic
1150393284 17:64802496-64802518 CTGTGGAGTTTTGGGGCAGGGGG - Intergenic
1151316362 17:73325054-73325076 CATTGGAGGTGGGGCGCAGAGGG - Intergenic
1151365890 17:73616310-73616332 CTGTTGAGGTGGGGAGCCGGGGG - Intronic
1152284316 17:79403519-79403541 CTGTGGAGCTGTGGGGCTGACGG - Intronic
1152631597 17:81413138-81413160 CTCTGGGGTTGGGGAGCGTATGG - Intronic
1152716535 17:81903157-81903179 CTCTCGAGTTGGGGAGCGAAGGG - Intronic
1155101401 18:22613867-22613889 GTGTATAGTTGGGGAGCAGGTGG - Intergenic
1155505183 18:26526241-26526263 CTGGAGATTTGGGGAGCAGCAGG + Intronic
1156550320 18:38009248-38009270 CTATGGGGTTGTGGAGCAGGGGG - Intergenic
1157088451 18:44606853-44606875 CCATGGAGTTGGGCAGAAGAGGG - Intergenic
1157146671 18:45170220-45170242 CTGTGAAGTTGTAGAGCAAAAGG - Intergenic
1157222895 18:45840027-45840049 CTGGGGAGTTAGTGAGGAGAGGG - Intronic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157559839 18:48638421-48638443 ATGTGGAGAAGGGGACCAGAGGG - Intronic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160389564 18:78519721-78519743 CTGTGGAGCTGGGGAGGTGTGGG - Intergenic
1160427119 18:78786130-78786152 GTGAGGAGTTGGGGAGGAGTGGG + Intergenic
1160529620 18:79555991-79556013 CTCTGGAGTGGAGGCGCAGAGGG + Intergenic
1160672765 19:374060-374082 GTGAGGAGTTTGGGAGCAAACGG - Intronic
1161614572 19:5262887-5262909 GTGAGGAGAAGGGGAGCAGAAGG + Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1161820733 19:6529255-6529277 CTGGGGGGTTGGGGATCAGGGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162318988 19:9959813-9959835 CTGGGGAGGTGGGGGGCAGGGGG + Exonic
1163629339 19:18409395-18409417 CTGAGGAGTTCGAGAACAGATGG - Intergenic
1163767660 19:19172334-19172356 CTGGGGAGTTGGGGTGCATAAGG - Intronic
1164227475 19:23258531-23258553 CTGAGGAGTTTGAGACCAGATGG - Intergenic
1164598397 19:29545275-29545297 CTGGGAACTTGGGGAGCAGGAGG + Intronic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165391809 19:35543324-35543346 CTGTGGTCTTGGGGAAGAGAAGG - Exonic
1166918396 19:46211738-46211760 CTGGGGAGTTGGGAAGCCCATGG - Intergenic
1167045784 19:47048075-47048097 CTGTGGAGTTGGGTACAAGATGG - Intronic
1167236607 19:48319448-48319470 CTTTGGAGATGGGGAGCATACGG - Exonic
1167708904 19:51098484-51098506 ATGTGGGGTTGGGAAGGAGACGG - Exonic
1168151715 19:54452605-54452627 CTGTGGATTTGGGCTGCTGACGG + Intronic
1168642606 19:58040120-58040142 CGGGGGGCTTGGGGAGCAGAGGG + Intronic
1168710588 19:58497905-58497927 CTTTGTAGGTGGGGAGCAGTGGG - Intronic
925169892 2:1744112-1744134 CTGGGGACTTGGGACGCAGAAGG - Intronic
925719205 2:6811687-6811709 CTGTGCTGTTGGGGACCAGCTGG + Intergenic
926188015 2:10706914-10706936 GTGTGGAGTGAGGGAGCAGTGGG + Intergenic
926382069 2:12300968-12300990 CAGTGGAGTTGTGGAGCTGGGGG + Intergenic
927847924 2:26480821-26480843 CTGTGGAGCTGGTGAGCTCAGGG + Exonic
927855239 2:26523649-26523671 CTGTGGTGTTAGGAGGCAGAGGG - Intronic
927969928 2:27299079-27299101 CTCTGAATTTGGGGAACAGAAGG - Intronic
928096260 2:28406912-28406934 CTGAGGAGGTGGGGAGGGGAGGG + Intronic
928307372 2:30181359-30181381 CGGTGGAGTTGGGGGACAGCTGG - Intergenic
928461128 2:31473659-31473681 CTGAGGAGGTGGTTAGCAGAGGG + Intergenic
928463255 2:31495630-31495652 CTGTCGGGGTGGGGAGCAGGGGG + Intergenic
928646927 2:33364575-33364597 CTATGGAGTGGCTGAGCAGATGG + Intronic
928753128 2:34494204-34494226 CAGTGCAGTGGGGGAGCTGAAGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929121146 2:38484917-38484939 CTGGGGAGGAGGGGAGCAGCAGG + Intergenic
929668449 2:43851726-43851748 CAGTCAAGTTGGGGAGCAGCTGG - Exonic
929671391 2:43878628-43878650 CTTTGGAGTTAGAGGGCAGAAGG + Intergenic
929906596 2:46051363-46051385 CTGTGAAGGTGGGGAGCTGTGGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930857453 2:56033922-56033944 CTGTGGAGAAGGGTATCAGAGGG - Intergenic
932040170 2:68291198-68291220 CAAGGGAGTTGGGGAGGAGATGG - Intronic
932099036 2:68879858-68879880 GTGTGGAGTGGGGCAGAAGATGG - Intergenic
932211773 2:69937425-69937447 CTCTGGGGTTGGGGAGCACAAGG - Intronic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932572389 2:72944971-72944993 CTGTGCAGCCGGGGAGCTGAGGG - Exonic
932717332 2:74111093-74111115 CTATGCAGTCCGGGAGCAGAGGG - Intergenic
933370553 2:81410137-81410159 CTGTGGAGGAGGGTTGCAGAGGG + Intergenic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
934097518 2:88620267-88620289 GTGTGGAGCTGGGAAGGAGAGGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935679320 2:105622214-105622236 CACTGGAGTCAGGGAGCAGAAGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936049102 2:109209609-109209631 CTGTGTAGGTGGGGAGGAAAGGG + Intronic
937067469 2:119028702-119028724 CTGTGGACTTGGGGAGCACCTGG + Intergenic
937538317 2:122918366-122918388 CAGTGGAGTTAGGGAGCTGATGG + Intergenic
938018171 2:127885327-127885349 CTGGGGAGTTGGGGAGACGATGG + Intronic
938411894 2:131072021-131072043 CTGTGGAGTTCTGGGGAAGAAGG - Intronic
939519730 2:143214611-143214633 CTGTAGAGTTGTGGAGAACATGG + Intronic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
941595185 2:167467575-167467597 TTGTAGAGCAGGGGAGCAGAAGG + Intergenic
942959455 2:181812499-181812521 CTGTGCAGTTGGTGGGCTGAAGG + Intergenic
943436571 2:187871037-187871059 CTGGGGAGAAGGGTAGCAGAAGG + Intergenic
944822093 2:203441238-203441260 CTGGGGAGTGGGGGAGGAGGGGG + Exonic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
945983875 2:216339306-216339328 GGGTGGAGATGAGGAGCAGAGGG - Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946194397 2:218024475-218024497 CTGCAGAGGTGGGGAGCTGATGG + Intergenic
946661990 2:222010998-222011020 CTGAGAGGGTGGGGAGCAGAAGG + Intergenic
947160856 2:227212619-227212641 CTGTGGTGTTGGTGTACAGATGG - Intronic
948119174 2:235516133-235516155 CCATGAAGTCGGGGAGCAGAAGG - Intronic
948128992 2:235586363-235586385 GTGTGGAGTTGGGAAAGAGACGG + Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
948627734 2:239279556-239279578 CTGTCGGGGTGAGGAGCAGAAGG + Intronic
948765308 2:240216434-240216456 CTGTGAAGTGGGGGTGCACAGGG - Intergenic
948820142 2:240538600-240538622 CTGGGGAGCTGTGGAGCAGGGGG - Intronic
948842173 2:240657169-240657191 CTGGGGAGCTGGGGAGGAGGGGG + Intergenic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169213848 20:3782810-3782832 CCCTGGAGTTGGAGACCAGAAGG - Intergenic
1169469550 20:5871975-5871997 CTGTGGAGTAGGGGAGTGGTTGG - Intergenic
1169732335 20:8799742-8799764 CTGTGGATTTGGGTATCTGAGGG - Intronic
1169826517 20:9774384-9774406 CCCTGGAGTTGGGGAGCCGCTGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171128768 20:22628602-22628624 CAATGCAGTTGGGGAGCTGAAGG + Intergenic
1171447208 20:25213334-25213356 CTGTGGCCTTGAGGACCAGAGGG - Exonic
1172589255 20:36105930-36105952 CTGGGGAGGAGGGGAGGAGAGGG - Intronic
1172697961 20:36835369-36835391 CTGTGGTTTTATGGAGCAGAGGG - Intronic
1172766899 20:37355843-37355865 CCATGGAGGTGGGGAGCAGCAGG + Intronic
1173236651 20:41252255-41252277 ATGAGAAGTTAGGGAGCAGAGGG + Intronic
1173785699 20:45791657-45791679 GGCTGGGGTTGGGGAGCAGAGGG - Intronic
1173856704 20:46254928-46254950 TTGGGGTGTTGGGGAGGAGAAGG + Intronic
1174064667 20:47855932-47855954 CTGTGGGGTTGGGGAGCATGAGG - Intergenic
1174140005 20:48406069-48406091 AGGAGGAGTTGGGGAGCAGGAGG + Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174402371 20:50282950-50282972 CCGTGGAGGTGGGGAGACGAGGG - Intergenic
1174533083 20:51230112-51230134 CTGTGGAGTTGGATAGCATAAGG + Intergenic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1176038181 20:63050419-63050441 GTGTGTGGTTGGGGAGCAGGTGG - Intergenic
1176205998 20:63888505-63888527 CTGTGCAGTTGGGGGGCTGTCGG - Intronic
1176206037 20:63888671-63888693 CTGTGCAGTTGGGGGGCTGTCGG - Intronic
1176206077 20:63888837-63888859 CTGTGCAGTTGGGGGGCTGTCGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1178359355 21:31935059-31935081 CTGTTGAGTAGCTGAGCAGAGGG + Intronic
1178804984 21:35831756-35831778 TTGAGGAGTTGGGGGGCAGCAGG - Intronic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179609467 21:42540480-42540502 CTTTGGAGTTGGGCAGCAGGAGG + Intronic
1179678473 21:43001015-43001037 CTGGGGTGCAGGGGAGCAGATGG + Intronic
1179721154 21:43316591-43316613 CCGTGGAGCTGGGGGGCTGAGGG + Intergenic
1180294486 22:10872832-10872854 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180497292 22:15902246-15902268 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1181062136 22:20286609-20286631 CTGTGGGGTGGGGGTGCAGCTGG + Intergenic
1181338792 22:22162228-22162250 CTGTGCAGTGGAGGAGGAGAGGG - Intergenic
1181457546 22:23068289-23068311 ATGTGGAGTGGGGGAGCATTGGG - Intronic
1181499507 22:23307849-23307871 CTGTGAAGTAGGGGGGCAGCTGG + Intronic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182146208 22:27998442-27998464 CAGTGGGGTTGGGGAGGGGAGGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183197296 22:36362261-36362283 CTATGGAGTAGGAGATCAGAGGG - Intronic
1183309334 22:37101015-37101037 CATTGGAGTTGGGGGGCAGAGGG + Intronic
1183468496 22:37992763-37992785 CTGTGGTGACTGGGAGCAGACGG - Intronic
1183678438 22:39312797-39312819 CAGTGGCCTTGGGGAGCACAAGG + Intergenic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1184754717 22:46509315-46509337 ATGAGGAGATGGGGTGCAGAGGG + Intronic
949948065 3:9205960-9205982 CTAGGGGGTTGGGGAGGAGAAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950100982 3:10356650-10356672 CTGTGGGGTTGGGAAGGACAGGG + Intronic
950214849 3:11152310-11152332 ATGAGGGGTTGGGGAGCAGAAGG - Intronic
951159954 3:19407434-19407456 CTGCGTAGGTGTGGAGCAGAGGG - Intronic
953133575 3:40163673-40163695 CTGTGGAATAGGGGAGCTGCTGG - Intronic
953152069 3:40333787-40333809 CTGTGTAGTTGGGGCGGGGAGGG - Intergenic
953749823 3:45600659-45600681 CTGCAGAGGTGGGGTGCAGAGGG + Intronic
953845457 3:46422866-46422888 CTGTGGAACAAGGGAGCAGATGG - Intergenic
954125372 3:48525103-48525125 CTGGGGAGTTGGGGAGACCATGG - Intronic
954224974 3:49175528-49175550 CTCTGGGCTTAGGGAGCAGAAGG + Intronic
954302097 3:49705511-49705533 CTGGGGAGTTGGGGAGGGAAGGG - Intronic
954526710 3:51278346-51278368 CTCTGGAGTTGGGGTGCATGAGG - Intronic
954672098 3:52296692-52296714 CTGTGGAAGTGGGGAGCTCAGGG + Intergenic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956767605 3:72497072-72497094 CTTGGGAGTTGGAGAGCACATGG - Intergenic
960942189 3:122942417-122942439 GTGTGGGGTTGGGGAGAGGATGG - Intronic
961362185 3:126375045-126375067 GTGTGGGGTTGGGGAGGATAAGG + Intergenic
961833004 3:129634026-129634048 CTTTGGAGCTTGGGACCAGAGGG - Intergenic
962342350 3:134596257-134596279 CTGTAAAGGTGGGTAGCAGAGGG - Intergenic
962580448 3:136793062-136793084 GTGGGGAGTTGGGGAGGAGAGGG - Intergenic
962871696 3:139501279-139501301 CTTTTTAGTTGAGGAGCAGACGG + Intergenic
963786277 3:149537693-149537715 CTGAGGAATTGTGGGGCAGATGG - Intronic
964951363 3:162298345-162298367 CTATGGAGCTGGGGAAGAGAAGG + Intergenic
965619657 3:170630010-170630032 GTGTGTAGTTGGGGAAAAGAAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
968044515 3:195616549-195616571 CTGTGGGCTTGGGGAGCATGAGG + Intergenic
968060303 3:195722600-195722622 CTGTGGGCTTGGGGAGCATGAGG + Intronic
968292676 3:197550793-197550815 TTCTGGAGCTGGGGGGCAGATGG - Intronic
968875424 4:3264646-3264668 CTGGGGAGTTGGGGAGATAATGG - Intronic
968945451 4:3661222-3661244 CAGAGGAGCTGGGGAGCGGAGGG + Intergenic
969227388 4:5807839-5807861 CTGTGAAGTGGCGGAGCAGAAGG - Intronic
970083227 4:12314413-12314435 CTCTGGAGCTGGGAAGTAGATGG + Intergenic
972289026 4:37673811-37673833 CTGTGTAGTTGCGGAGGATAGGG - Intronic
973816499 4:54624360-54624382 CAGTGGAGCTGGGGAACAGCTGG + Intergenic
974302576 4:60087044-60087066 CTGGGGTGTTGGGGAGCAAAGGG + Intergenic
977522656 4:98104877-98104899 TTGGGGTGTTGGGGAGTAGATGG - Intronic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978275658 4:106946850-106946872 CTAGGGATTTGAGGAGCAGAAGG - Intronic
980270566 4:130578839-130578861 CTGAGGAGCTGGGGAGAAGCAGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
982073132 4:151713319-151713341 CTGTGGACTTGGGGGGCCGAAGG - Intronic
983274091 4:165596564-165596586 CAGTGGAGTTGGGGAACAAGAGG + Intergenic
983740153 4:171120771-171120793 CTGTGGAATTGGGAAGACGATGG - Intergenic
985042173 4:185902429-185902451 CTGTGCAGTTGGAGAGTAAATGG + Intronic
985641020 5:1063606-1063628 AGGTGGAGGTGGGGAGGAGAAGG - Intronic
986640948 5:9871550-9871572 GTGTGCAGTTGGGGAGGACAAGG - Intergenic
987113194 5:14705920-14705942 CTCTGGAGTTGGGGAACATTAGG - Exonic
987156490 5:15094947-15094969 CTGAGGAGTTGGGGAGAATGAGG - Intergenic
987249397 5:16082921-16082943 CCATGGAGTGGGGGTGCAGAAGG - Intronic
987801395 5:22701329-22701351 CTGTGGAGTTGGAGAACATTAGG - Intronic
988496017 5:31746940-31746962 CTGAGGCGTTGGGGAGCATGAGG + Intronic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989150192 5:38291354-38291376 GTCTGGATTTGGGGAGGAGAAGG + Intronic
989557061 5:42809592-42809614 CTTTGGAGGTGGGGAGCTAATGG + Intronic
990149724 5:52802288-52802310 GTGTGGAGGTGGGGAGAAAAGGG - Exonic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990724376 5:58736976-58736998 CTGTGAAGTTTTGGAGCAGAGGG - Intronic
990995267 5:61726753-61726775 CTCTGGAAGTGGGGAGCAAAGGG + Intronic
991018862 5:61959463-61959485 ATATGGACTTGGGGAGGAGACGG - Intergenic
992030240 5:72713718-72713740 CTGAGAACTAGGGGAGCAGATGG - Intergenic
992988178 5:82255105-82255127 CTGTGGGGTTGAGAAGCAGAGGG - Exonic
993246629 5:85459926-85459948 CCATGGAGCTGAGGAGCAGATGG - Intergenic
994631386 5:102292450-102292472 TTTTGGAGTTGGGGAGAGGAGGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996494731 5:124140780-124140802 CTCTGAAGGTGGGGAGAAGAAGG + Intergenic
996690743 5:126337289-126337311 GTGTGGAGTTGGCGAGGGGAAGG + Intergenic
997880468 5:137584544-137584566 GTGAGGACTTGGGGAGCAGCAGG - Intronic
997998627 5:138606475-138606497 CTTGGGAGTTGGGGAGGAGGAGG - Intergenic
998674353 5:144390416-144390438 TTGTGGGGTTGGGGAGCTGGGGG + Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999069434 5:148728276-148728298 CTGAGGAGTGGGGGTGGAGATGG - Intergenic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999550383 5:152680158-152680180 CTGTGGTGCTGGGGAGGGGAGGG - Intergenic
999620576 5:153468467-153468489 ATGGGGTGTTGGGGAACAGAAGG - Intergenic
999666741 5:153920613-153920635 ATGGGGAGGTGGGAAGCAGAAGG - Intergenic
999779980 5:154841394-154841416 CTGTGGACTTGGGGGTTAGAGGG + Intronic
1000433461 5:161179658-161179680 GTGTGGGGTTGGGGAGGAGGTGG - Intergenic
1002213614 5:177612511-177612533 GTGGGGAGGTGGGCAGCAGAGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003259163 6:4500902-4500924 CTGTGGTGTTGGGCAGCATGGGG + Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1005950269 6:30626570-30626592 CTGTGGAGTGGGGGCCCACAAGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007448613 6:41926153-41926175 ATGGGCAGTTTGGGAGCAGAAGG - Intronic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1007617063 6:43186448-43186470 CTGTGCAGGTGGGCAGCACATGG + Exonic
1007675926 6:43594946-43594968 CTGGGGAGGTGGGGGGCATATGG + Intronic
1008051306 6:46902821-46902843 CTGAGGAGTTGGGATGGAGATGG + Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010187730 6:73162553-73162575 ATGTGTAGTTGGAGAACAGAGGG + Intronic
1010450595 6:75997899-75997921 CTGTGGAATCAGGGAACAGATGG + Intronic
1010495774 6:76532650-76532672 CTGAGGAGTTGGGGTGTTGAAGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1013890117 6:115016797-115016819 CTGTGTAATTGGGCAGCAGGGGG - Intergenic
1014550334 6:122782793-122782815 AGATGGAGGTGGGGAGCAGAGGG + Intronic
1014886074 6:126782976-126782998 TAGTGGAGTTGGGGAACAGCTGG + Intergenic
1016471548 6:144379907-144379929 CTGTGGAGGAGTGGAGGAGAAGG + Intronic
1017739955 6:157398023-157398045 CTGGGGAGCTGGGGGGCTGAGGG - Intronic
1017739958 6:157398031-157398053 CTGGGGAGCTGGGGAGCTGGGGG - Intronic
1017739969 6:157398055-157398077 CTGGGGAGCTGGGGAGCTGGGGG - Intronic
1018753509 6:166828313-166828335 GTGTGGAGTTGGGGAGGAAGGGG - Intronic
1020390657 7:7654471-7654493 CTGTGGATTTGGGTATCAGCAGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022259185 7:28687773-28687795 AGGTGGAAGTGGGGAGCAGAGGG + Intronic
1023022991 7:36027705-36027727 CTGAGGAGTTCTGGGGCAGAAGG + Intergenic
1023083653 7:36548534-36548556 GAGTGGAGTTGGTGAGGAGAGGG + Intronic
1023203075 7:37719935-37719957 CTTTGGAAATGGGGAGCAGCAGG + Intronic
1023857397 7:44193098-44193120 CTGATGAATTGGGGAGCAGGTGG + Intronic
1023877432 7:44294654-44294676 TTGGGGAGATGAGGAGCAGAGGG - Intronic
1024506898 7:50169406-50169428 CAATGAGGTTGGGGAGCAGAGGG - Intergenic
1024557387 7:50615296-50615318 CTGGAGAGTTGAGGAGGAGAAGG - Intronic
1024803895 7:53113697-53113719 CAGCAGAGTTGGGGGGCAGAAGG - Intergenic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1028121435 7:87059758-87059780 CGCTGGAGCTGGGGAGCAGGTGG + Intergenic
1029128672 7:98313201-98313223 CTGTGGAGTTGGGATGAAGCAGG - Intronic
1029277904 7:99418477-99418499 GTGTGGAGCTGGGGAAAAGAAGG - Exonic
1029347369 7:99988146-99988168 GTGTGGAGATGTGGAGCAGCTGG - Intergenic
1029488773 7:100859029-100859051 CCCTGGAGAGGGGGAGCAGAGGG - Exonic
1030586429 7:111425240-111425262 CTGTGAGGTGTGGGAGCAGAAGG + Intronic
1031448060 7:121879332-121879354 CTCTGGTGTTGGGGAGGAGAGGG + Intronic
1032552292 7:132795671-132795693 CTATGGAGTTTGTCAGCAGAAGG + Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1036065754 8:5379880-5379902 CTGTGGAGTTGAGGTGTAGTAGG - Intergenic
1036085823 8:5611741-5611763 TCCTGGAGTGGGGGAGCAGAAGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037897099 8:22665141-22665163 CTTTGGAGTGGAGGATCAGAAGG + Intronic
1038023856 8:23571965-23571987 CTAAGGCATTGGGGAGCAGAGGG - Exonic
1039446083 8:37633966-37633988 CTCTGGAGTTGGCCTGCAGAAGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039983071 8:42425506-42425528 CCGTGTAGTTGGAGAGCAGATGG - Intronic
1041618493 8:59935960-59935982 TTGTGGAATTGGGCAGTAGAAGG + Intergenic
1041945974 8:63443430-63443452 TTTTGGTGTTTGGGAGCAGAGGG + Intergenic
1043239938 8:77920108-77920130 CTACGGAGTTGGGGAGAAAAAGG - Intergenic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1045414496 8:101952623-101952645 CTGTGGGCTTTGGGAGCTGATGG - Intronic
1045414660 8:101953861-101953883 CTGTGGGCTTTGGGAGCTGATGG + Intronic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1045489981 8:102660729-102660751 TTGTCGAGTTGGGGATCAGGTGG + Intergenic
1045649831 8:104331194-104331216 GTAGGGACTTGGGGAGCAGAAGG - Intronic
1046256070 8:111697439-111697461 GTGTAGAGTTGGGGAGAAGAGGG + Intergenic
1046675835 8:117107390-117107412 CATTGGATTTGAGGAGCAGATGG + Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048303146 8:133265983-133266005 CAGGGCAGTTGGGGAGCAGGAGG + Intronic
1049001210 8:139826556-139826578 CGGTGGAGTGGGGCAGCAGGAGG + Intronic
1049046885 8:140159422-140159444 CTAAGGAGTTGGAGAGCAGTGGG - Intronic
1049587574 8:143439144-143439166 CTCTGGGGTCGGGGAGCAGATGG - Intronic
1049672230 8:143875056-143875078 CTGCAGATTTGGGGAGCTGAGGG - Intronic
1049797489 8:144503332-144503354 CTGTGGAGGTGGGGCTCTGACGG + Intronic
1049831597 8:144704592-144704614 CTGGGGAGGAGGGGAGCAGGTGG + Intergenic
1053036623 9:34832084-34832106 CAGTGGAGATAAGGAGCAGATGG + Intergenic
1053390757 9:37734120-37734142 CTGTGGAGTTTGGAGACAGAAGG + Intronic
1053423572 9:37996646-37996668 CTGGGGAGGTGGGGACCAGCAGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056388111 9:86116161-86116183 CTGTGGTTTTGGCGAGCACAGGG - Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1056701505 9:88914941-88914963 CTGTGGAGTGAGTGAGGAGAGGG + Intergenic
1056773221 9:89494779-89494801 GTGTGGGGTGGGGAAGCAGAGGG - Intronic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057486262 9:95486868-95486890 CTGTGGAGTGGGGGAGCTCTAGG - Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057667607 9:97058036-97058058 CTTTGGTGGTGGGCAGCAGATGG - Intergenic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058031353 9:100201542-100201564 AACTGGGGTTGGGGAGCAGATGG - Intronic
1059429536 9:114241506-114241528 CTGTGGGGGTGGGGAGCACCTGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059660582 9:116396406-116396428 CACTGGATTTGAGGAGCAGAAGG - Intronic
1060014175 9:120071972-120071994 CTCTGGGGTTAGGGAGCACAGGG - Intergenic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1060864821 9:126987337-126987359 TTGGGGAGTTGGGGGGCAGTTGG + Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1061329280 9:129881998-129882020 CTGTGGAGGTGAGCAGAAGAGGG + Intergenic
1061588315 9:131582801-131582823 CTGTGGAGTTGGGCAGAGGGTGG - Intronic
1061782176 9:133002813-133002835 GTCTGGGGTTGGGGAGCAGGTGG + Intergenic
1062075964 9:134590126-134590148 CTGGGGTGTGGGGGATCAGAAGG + Intergenic
1062494410 9:136825043-136825065 CTGGGGACTGGGGGAGCTGATGG - Intronic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1186151103 X:6675685-6675707 CTCTCTACTTGGGGAGCAGAGGG - Intergenic
1186390200 X:9151143-9151165 CTCTGGAATGCGGGAGCAGAAGG + Intronic
1186436572 X:9547863-9547885 CTGTGGAGTTGGGCTTGAGAGGG - Intronic
1186499571 X:10040565-10040587 CTATGGAGTTGGGATGCACACGG + Intronic
1186928054 X:14357037-14357059 GTGTGGAGTTGGGTATGAGATGG + Intergenic
1187243992 X:17537897-17537919 CTGAGCAGATGGGGATCAGAGGG + Intronic
1187410905 X:19049792-19049814 TAGTGGAGTTGGGGAGGAGAGGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187877483 X:23816291-23816313 CTGAGGAGTTGGGAAGAGGAAGG - Intergenic
1189208442 X:39262146-39262168 GTGTGGACTTGGGGATCAGGAGG + Intergenic
1189336062 X:40171623-40171645 GCGTGGAGTAGGGGAGCAGGGGG + Intronic
1190463807 X:50705771-50705793 GTGTGGAGTAGGGGGGCAGAAGG - Intronic
1192156684 X:68752057-68752079 CTGTGGAGTCAGTGAGCAGATGG + Intergenic
1192264913 X:69531402-69531424 GTGTGGGGTTGGGGAGTAGGGGG + Exonic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1195069662 X:101266973-101266995 CTGTGAAGTTGGGATGGAGACGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195263784 X:103160590-103160612 CAATGGAGTTGGGGTGGAGAAGG + Intergenic
1195938859 X:110150297-110150319 CTGTGGCAATGGGGAGCACAAGG + Intronic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198571131 X:137958447-137958469 GTTTGGATTTGGGGAGCATATGG - Intergenic
1198767568 X:140094433-140094455 CTGGGGGGTTGGGGAGGGGAGGG + Intergenic
1199136079 X:144254775-144254797 TTGTGGAGGTGGGGAGTACAAGG - Intergenic
1199936312 X:152577028-152577050 CTGTGGATTTGGGTATCTGAGGG - Intergenic
1200039668 X:153355991-153356013 CTGGGGAGTTGGGGAGTGGAGGG - Intronic
1200466756 Y:3528968-3528990 CAGTGAAGTTGGGGAGCTGTGGG + Intergenic