ID: 903652371

View in Genome Browser
Species Human (GRCh38)
Location 1:24929927-24929949
Sequence GGCCGAGGAGGCGCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 336}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903652371_903652380 14 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652380 1:24929964-24929986 AAGCGGGAAAGCAGAAGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 185
903652371_903652384 22 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652384 1:24929972-24929994 AAGCAGAAGCGGCGGGGCCCGGG 0: 1
1: 0
2: 2
3: 13
4: 224
903652371_903652381 15 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652381 1:24929965-24929987 AGCGGGAAAGCAGAAGCGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 173
903652371_903652376 -2 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652376 1:24929948-24929970 CCGCCGCTGCCGCGAGAAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 104
903652371_903652374 -3 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652374 1:24929947-24929969 GCCGCCGCTGCCGCGAGAAGCGG 0: 1
1: 0
2: 0
3: 14
4: 119
903652371_903652386 30 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652386 1:24929980-24930002 GCGGCGGGGCCCGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 46
4: 369
903652371_903652379 11 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652379 1:24929961-24929983 GAGAAGCGGGAAAGCAGAAGCGG 0: 1
1: 0
2: 2
3: 47
4: 502
903652371_903652382 16 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652382 1:24929966-24929988 GCGGGAAAGCAGAAGCGGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 228
903652371_903652383 21 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652383 1:24929971-24929993 AAAGCAGAAGCGGCGGGGCCCGG 0: 1
1: 1
2: 3
3: 24
4: 348
903652371_903652385 29 Left 903652371 1:24929927-24929949 CCGGCGCGGGCGCCTCCTCGGCC 0: 1
1: 0
2: 4
3: 37
4: 336
Right 903652385 1:24929979-24930001 AGCGGCGGGGCCCGGGCCTCAGG 0: 1
1: 0
2: 5
3: 54
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903652371 Original CRISPR GGCCGAGGAGGCGCCCGCGC CGG (reversed) Intronic