ID: 903652993

View in Genome Browser
Species Human (GRCh38)
Location 1:24932422-24932444
Sequence CTCCGCGGCTGGCAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 413}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903652993_903653004 -6 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653004 1:24932439-24932461 GCGGAGGTGCGGGCCCGGCCGGG 0: 1
1: 0
2: 4
3: 59
4: 411
903652993_903653009 23 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653009 1:24932468-24932490 ATGCGCGCCAGCTGCGGCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 104
903652993_903653008 17 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653008 1:24932462-24932484 CTACAGATGCGCGCCAGCTGCGG 0: 1
1: 0
2: 1
3: 4
4: 54
903652993_903653012 30 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653012 1:24932475-24932497 CCAGCTGCGGCCCCGGGTGCAGG 0: 1
1: 0
2: 3
3: 39
4: 331
903652993_903653003 -7 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653003 1:24932438-24932460 CGCGGAGGTGCGGGCCCGGCCGG 0: 1
1: 0
2: 0
3: 43
4: 334
903652993_903653010 24 Left 903652993 1:24932422-24932444 CCCGCGCCCTGCCAGCCGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 413
Right 903653010 1:24932469-24932491 TGCGCGCCAGCTGCGGCCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903652993 Original CRISPR CTCCGCGGCTGGCAGGGCGC GGG (reversed) Intronic
900393442 1:2443653-2443675 CTCCGCGGCGGGCACCGGGCTGG - Intronic
900476309 1:2877979-2878001 CTCCAGGGCTGGCAGGGAACAGG + Intergenic
901236867 1:7671893-7671915 CCCCGGGGCTGGCAGAGTGCCGG + Intronic
901341525 1:8501627-8501649 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
901341548 1:8501675-8501697 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
901970373 1:12903047-12903069 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
902014792 1:13298722-13298744 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
902018791 1:13328765-13328787 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
902897051 1:19485907-19485929 CACCGCGGCTGGGAGGGGACCGG + Intergenic
903637841 1:24833684-24833706 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
903735960 1:25530120-25530142 CTGAGCGGGTGGGAGGGCGCTGG - Intergenic
903750323 1:25617173-25617195 CTCCGCCGCGGAGAGGGCGCCGG - Intergenic
904054251 1:27659839-27659861 CCCCGCGGCGGGCCGGGCACAGG - Intergenic
904379797 1:30103045-30103067 CTCCGCGTCTGCCAGGCCGCAGG + Intergenic
904591553 1:31618056-31618078 CTCGGGGGCTGGCGGGGCTCCGG - Intronic
904673007 1:32180033-32180055 CCTCGCGGCAGGCCGGGCGCGGG - Intronic
904772299 1:32886938-32886960 CTCCGAGGGTGGCAGGGCCCAGG + Intronic
904784581 1:32974596-32974618 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
904784704 1:32974868-32974890 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
904799211 1:33081169-33081191 CTGCTGGGCTGGCGGGGCGCAGG + Exonic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
905869459 1:41394822-41394844 CTCCCCTGCTGGCAGGACCCTGG + Intergenic
906761758 1:48383156-48383178 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
907294110 1:53438836-53438858 CGCCGTGGCTCGCAGGGTGCTGG + Intergenic
907297025 1:53461747-53461769 CTCGGGGGCTGGCATGGCGTGGG - Intronic
908009339 1:59759563-59759585 CTCCGCTGCTTGCTGGGAGCTGG + Intronic
908370284 1:63473485-63473507 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
908544035 1:65147585-65147607 CTCCGCGACTGGGCGGGCGGAGG + Intronic
909478957 1:76112396-76112418 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
909641047 1:77870067-77870089 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
912116372 1:106412736-106412758 CTTGGCGGCTGGCCGGGCGGGGG - Intergenic
912246343 1:107965161-107965183 CTCAGTGGCGGGCCGGGCGCTGG - Intergenic
912751769 1:112293549-112293571 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
912751923 1:112293901-112293923 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
913289758 1:117261256-117261278 CTCTGCAGCTGGCAGAGCACAGG + Intergenic
913993837 1:143638042-143638064 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
913994044 1:143638520-143638542 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
914888101 1:151600638-151600660 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
915410917 1:155700756-155700778 CGGCGCGGCTGGCTGGGCGGAGG - Intronic
915517282 1:156420898-156420920 CTCCGCCGAAGGCAGGGCTCTGG - Intronic
915539269 1:156557302-156557324 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
915539490 1:156557764-156557786 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
916037370 1:160933460-160933482 CGGGGCGGCTGGCAGGGCGGGGG - Intergenic
916087428 1:161281491-161281513 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
916671973 1:167029807-167029829 CTGGGCGGCTGGCAGGGCGGGGG - Intergenic
919727107 1:200891572-200891594 CTCCGGGGAGGGCAGGCCGCAGG + Intronic
920215608 1:204359853-204359875 CTCTCCGGCTGGCAGGTCCCTGG + Exonic
920912914 1:210233906-210233928 CACAGCGGCTGGCAGGGCTCTGG - Intronic
921140219 1:212298903-212298925 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1063442772 10:6086490-6086512 CTCAGCGCCTGGCAGGAGGCTGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064190320 10:13200361-13200383 CTCTGTGGCTGGCAGGGACCGGG - Intronic
1064622399 10:17229197-17229219 CTCCGCGGCTGGGATGGCAGTGG + Intronic
1066085465 10:31970202-31970224 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1068969605 10:62947787-62947809 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1069789927 10:71013022-71013044 CTCAGCGCCTGGCAGGGAGGGGG + Intergenic
1070999158 10:80814374-80814396 CTCCCCGCCAGGCAGGGCTCCGG + Intergenic
1071404848 10:85319983-85320005 CTCTGCAGCTGGCAGAGCCCTGG - Intergenic
1072180501 10:92975804-92975826 CGGGGCGGCTGGCCGGGCGCGGG - Intronic
1075802284 10:125160752-125160774 CTCGGCGGGCGGGAGGGCGCGGG - Intronic
1076731972 10:132443846-132443868 CCCAGCTGCTGGCTGGGCGCTGG - Intergenic
1076842055 10:133050541-133050563 CTCCGAGGCAGGGAGGGCGGTGG + Intergenic
1076993948 11:289371-289393 GTCCGGGGCTGCCGGGGCGCCGG - Intronic
1077021947 11:420873-420895 CTGCGTGGCAGGGAGGGCGCAGG + Intronic
1077131306 11:974087-974109 ATCTGCGGCTGGAAGGGAGCAGG + Intronic
1077441108 11:2569671-2569693 CACCCCGGCTGCCTGGGCGCTGG + Intronic
1077839700 11:5961099-5961121 CGGGGCGGCTGGCCGGGCGCGGG - Intergenic
1078091594 11:8267853-8267875 CTCCGCCCCTGGCAGGGCTAGGG - Intronic
1080119867 11:28664715-28664737 CTCGGGGGCTGGCATGGGGCAGG + Intergenic
1080860185 11:36144992-36145014 CGGGGCGGCTGGCAGGGCGGGGG - Intronic
1083272984 11:61581282-61581304 CTGCGAGGCGGGCGGGGCGCGGG - Intergenic
1083920984 11:65781266-65781288 CTGCGCGGCTTGGCGGGCGCTGG - Intergenic
1084049091 11:66588210-66588232 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1084049114 11:66588259-66588281 CTGGGCGGCTGGCAGGGCGGGGG - Intergenic
1084171287 11:67401994-67402016 CTCGGCGGCGGGCTGGGGGCGGG + Intronic
1084924774 11:72502615-72502637 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1085011452 11:73143990-73144012 CCCCGCAGCTGTCAGGGCCCTGG - Intergenic
1085292453 11:75410094-75410116 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1085982784 11:81744657-81744679 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1088522351 11:110712767-110712789 TTCCGCCGCGGGCACGGCGCGGG - Intronic
1088604182 11:111512708-111512730 CTCCCGGCCTGGGAGGGCGCGGG + Intergenic
1089421042 11:118331739-118331761 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
1090780340 11:130002090-130002112 CTCCGGGGCTGGCCGGTTGCGGG - Intronic
1091218622 11:133918225-133918247 CTCCTCGGCTGGGCGGGCGGGGG - Intronic
1091712707 12:2753147-2753169 CCCAGGGGCAGGCAGGGCGCAGG - Intergenic
1092046146 12:5432903-5432925 CTCAGCGGCCGGCAGAGTGCAGG - Intronic
1092331278 12:7589832-7589854 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1092453703 12:8625532-8625554 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1092827498 12:12413910-12413932 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1092827724 12:12414409-12414431 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1092827775 12:12414536-12414558 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1094682677 12:32679671-32679693 CTCCGCCCCTGGCCGGGCCCCGG - Intronic
1095571157 12:43685371-43685393 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1096660813 12:53122987-53123009 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1096972800 12:55681373-55681395 GTCGGGGGCTGGCAGGGCGTTGG - Intergenic
1098910537 12:76204242-76204264 CTCCGGGGCCGACAGGGTGCAGG - Intergenic
1099443842 12:82728952-82728974 CTCCCCGCCAGGCAGGGCTCGGG + Intronic
1100570623 12:95841244-95841266 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1103391986 12:120581100-120581122 CTTCGCGGGTGCAAGGGCGCTGG - Exonic
1103623836 12:122204335-122204357 CTCCGCGGCTCGGAGGGCGGCGG + Intronic
1104001567 12:124863757-124863779 CTCCGCGCCTGGCAGGAGACGGG + Exonic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1106217981 13:27720233-27720255 GTCCCCGGCTGGCAGGGAACAGG + Intergenic
1107770923 13:43786925-43786947 CTCCGCGGCTGGAGGCGCGCGGG + Intergenic
1108196604 13:48001420-48001442 CTCCGCGCCCGCCAGGGAGCTGG - Intergenic
1108541587 13:51452025-51452047 CTCCTCTGCTGGCAGGGTCCCGG + Exonic
1109858833 13:68171148-68171170 CTCCGCGCGGGGCAGGGCGCGGG + Intergenic
1110318585 13:74135515-74135537 CGCGGCGGCTCGGAGGGCGCGGG + Intergenic
1113082709 13:106535136-106535158 CTCCGGGGCCCTCAGGGCGCGGG + Intergenic
1113436075 13:110292092-110292114 CTCAGCGGCAGGCAGGATGCAGG - Intronic
1113563675 13:111304266-111304288 CACCGCGGCTCGCTGGGCCCAGG + Intronic
1113820358 13:113208995-113209017 CTCCGCGCCTGGCTGGGCCAGGG + Intronic
1114199186 14:20506325-20506347 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1114427747 14:22637421-22637443 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1115235631 14:31207080-31207102 CGCCGGGCCAGGCAGGGCGCCGG + Exonic
1115235664 14:31207200-31207222 CCCCGCCGCCGGCAGGGCCCCGG + Exonic
1118341119 14:64895550-64895572 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1118797149 14:69153430-69153452 CTCCGCGGAGTGCGGGGCGCTGG - Intergenic
1121350638 14:93170248-93170270 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1122338110 14:101007136-101007158 AGCCCCGGCTGGCAGGGGGCCGG - Intergenic
1122568240 14:102676706-102676728 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1125429502 15:39581066-39581088 CGCAGCGGCTGGCAAGGCGGAGG - Intronic
1125689604 15:41585483-41585505 CCCCGCGGCCTGCAGGGCGCCGG - Intergenic
1126102707 15:45129472-45129494 TTCCGGGTCTGGCGGGGCGCGGG + Exonic
1126295533 15:47132932-47132954 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1126295600 15:47133076-47133098 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1126571648 15:50158493-50158515 CTGGGCGGCTGGCCGGGCGGAGG - Intronic
1127154193 15:56110103-56110125 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1127165784 15:56243837-56243859 CTCCGGGGCTGGCAGGGCAGCGG - Intergenic
1127584409 15:60366985-60367007 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1128344197 15:66843054-66843076 CTCTGCAGCTTCCAGGGCGCAGG - Intergenic
1128843687 15:70871557-70871579 CGGCGCGGCTGGCCGGGCGGGGG + Intronic
1128970213 15:72100932-72100954 CGCGGCGGCTGGCCGGGCGGGGG - Intronic
1129446997 15:75625624-75625646 CTCGGCAGCTGGCGGGGCCCGGG + Exonic
1130997830 15:88913480-88913502 CTCCGCGGCTGGGAGGGAATTGG + Intergenic
1131249819 15:90822955-90822977 CTCCCAGGCTGGCAGGGCCTGGG - Intergenic
1132462462 16:62213-62235 CTCCGGGGATGGCAGGGAGCTGG + Intronic
1132552899 16:560640-560662 CTCCGCTCCCGGCCGGGCGCAGG + Exonic
1132683686 16:1153658-1153680 CGCCGCGGGAGGCAGGGCGGGGG + Intronic
1132686756 16:1165486-1165508 CTCCCCGGCTGTGAGTGCGCAGG - Intronic
1132915428 16:2341199-2341221 CCCCGCCTCTGGCCGGGCGCTGG + Intergenic
1132915728 16:2342085-2342107 GCCGGCGGCTGGCTGGGCGCGGG - Intergenic
1133018691 16:2956415-2956437 CCCCAAGGCTGGCAGGGCCCGGG - Intergenic
1133097581 16:3457999-3458021 CTGCGCTGCCGGCAGGGAGCGGG + Intronic
1133364963 16:5202774-5202796 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1134236406 16:12469717-12469739 CTGCAGGGCTGGCTGGGCGCAGG + Intronic
1134854216 16:17505795-17505817 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1136572211 16:31104641-31104663 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1136572397 16:31105071-31105093 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1136572420 16:31105120-31105142 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1137304030 16:47181531-47181553 CTCCCCGTCTGGCAGGGAGGTGG + Intronic
1138265278 16:55656006-55656028 CGGGGCGGCCGGCAGGGCGCGGG - Intronic
1139340616 16:66265654-66265676 CTGTGCGGCTGGCAGAGAGCAGG - Intergenic
1139600308 16:67982453-67982475 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1139864260 16:70051293-70051315 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1139864416 16:70051644-70051666 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1141184689 16:81779135-81779157 CTCCATGGCGGGGAGGGCGCGGG + Intronic
1142011059 16:87714377-87714399 CTCCGCTCCGGGCAGGGTGCAGG + Intronic
1142509741 17:386029-386051 TTCCGGGGCCGGCGGGGCGCGGG - Intronic
1142799537 17:2336968-2336990 CTCCGTGGGAGGCGGGGCGCAGG - Exonic
1142818642 17:2447590-2447612 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1142818697 17:2447717-2447739 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1143107161 17:4535597-4535619 CTCCGAGGCTCGGAGGGCTCTGG + Intronic
1143554467 17:7651791-7651813 CTCCCCGGCTGGCCGTGCGGAGG + Intronic
1144541358 17:16145682-16145704 CTGGGCGGCTGGCTGGGCGGGGG - Intronic
1147172647 17:38631079-38631101 CGGGGCGGCTGGCCGGGCGCGGG - Intergenic
1150412414 17:64956345-64956367 CTGCGCAGCTGGCATGGCCCTGG + Intergenic
1150527400 17:65937706-65937728 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1150638587 17:66933879-66933901 CTCCACGGCTGGCGGGGGGGGGG + Intergenic
1150799481 17:68269278-68269300 CTGCGCAGCTGGCATGGCCCTGG - Exonic
1151826787 17:76528287-76528309 CTGAGCGGCTGGCAGGAAGCGGG - Exonic
1152020181 17:77776631-77776653 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1152363207 17:79841824-79841846 CTCCGCGGCTGGCCCAGCCCGGG - Intergenic
1152696133 17:81797849-81797871 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1153900770 18:9614941-9614963 GGCTGCGGCTGGCAGGGCGGTGG - Intronic
1154278231 18:12979977-12979999 CGGGGCGGCTGGCCGGGCGCGGG + Intronic
1154278394 18:12980347-12980369 CAGGGCGGCTGGCAGGGCGGGGG + Intronic
1156310396 18:35917222-35917244 CTCCTCTGCTGGCAGGGTGAAGG - Intergenic
1159016341 18:63104347-63104369 CTCCGCAGCTGTCGGGGAGCAGG + Intergenic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1160690994 19:460689-460711 CTCAGCCGCTGTCGGGGCGCGGG - Exonic
1160727140 19:622348-622370 TGCCGCGGCAGGCAGGGCTCGGG + Exonic
1160835479 19:1122754-1122776 CTCCCCAGCGGGCAGCGCGCGGG - Exonic
1160972750 19:1776671-1776693 CTCCGAGACTGGCCGGCCGCGGG + Exonic
1161080575 19:2308084-2308106 CTCCGCCGCGGACACGGCGCGGG + Intronic
1161400081 19:4063405-4063427 CTCAGAGGCGGGCAGGGCTCTGG - Intronic
1162496418 19:11025516-11025538 CGCCGCGGCTGGGACGGCTCAGG + Intronic
1162695152 19:12468082-12468104 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1162773629 19:12965555-12965577 CTCCGTGGAGGGGAGGGCGCGGG + Intronic
1162913503 19:13862394-13862416 CTCCACAGCTGGGAGGGCGCTGG + Intronic
1162987123 19:14277836-14277858 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1163248480 19:16111750-16111772 CCCCGCGACTGGCGGGACGCAGG + Exonic
1164066572 19:21721476-21721498 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1164191640 19:22923539-22923561 GTCCGCTGTTGGAAGGGCGCAGG - Intergenic
1164214665 19:23134398-23134420 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1164977016 19:32581115-32581137 CCGCGCCGCTGCCAGGGCGCCGG - Exonic
1165481874 19:36069148-36069170 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1165922659 19:39308366-39308388 CTCAGCGGGCGGCAGGGCGCCGG + Exonic
1166162956 19:40966242-40966264 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1166364847 19:42273104-42273126 CTCCCCTCCTGGCAGGGCGAGGG - Intronic
1167970896 19:53187401-53187423 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1168310295 19:55456568-55456590 CTCAGAGCCTGGCAGGGCCCGGG + Intronic
1168659912 19:58157533-58157555 CTCCCCGCGTGGCAGGGCTCGGG + Intergenic
1168696028 19:58405019-58405041 CAGGGCGGCTGGCAGGGCGGGGG + Intronic
925373640 2:3365927-3365949 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
925403367 2:3590833-3590855 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
925403415 2:3590931-3590953 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
925403548 2:3591233-3591255 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
925407540 2:3615876-3615898 CGCGGCGGCTGGCCGGGCGGGGG + Intronic
926474762 2:13308465-13308487 CTCCCCGCCGGGCAGGGCTCAGG - Intergenic
928002983 2:27539992-27540014 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
928003144 2:27540373-27540395 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
928557942 2:32447455-32447477 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
928558041 2:32447679-32447701 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
928964982 2:36966810-36966832 CTCTGGGGCCGGCTGGGCGCGGG + Intergenic
929447701 2:42014385-42014407 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
929522671 2:42668427-42668449 TTCCGAGGCTGGAAGGTCGCAGG - Intronic
929690064 2:44066952-44066974 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
929739676 2:44588612-44588634 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
929739699 2:44588660-44588682 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
929739775 2:44588836-44588858 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
929777753 2:44939212-44939234 CTCCGGGGCTGGCCGGGCAGTGG + Intergenic
929861850 2:45684865-45684887 CTGTGTGGCTGGCAGGGGGCTGG + Intronic
930079337 2:47433631-47433653 CTGGGCGGCTGGCTGGGCGGGGG + Intronic
931656244 2:64512244-64512266 CTTGGCGGCTGGCCGGGCGGGGG + Intergenic
932555978 2:72825527-72825549 CTCCGAGGCTGGTCCGGCGCTGG - Intronic
932710725 2:74061395-74061417 CGGGGCGGCTGGCAGGGCGGGGG + Intronic
932710749 2:74061444-74061466 CGGGGCGGCTGGCAGGGCGGGGG + Intronic
932798122 2:74715470-74715492 GTCCGCGGCTGGCAGGGCCTGGG + Intergenic
935630748 2:105210942-105210964 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
935630801 2:105211069-105211091 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
937421037 2:121755616-121755638 CTCCGAGGCTCGCGGCGCGCCGG - Exonic
937917659 2:127106828-127106850 CTCCGCGGCTGCTGGGGCTCCGG + Intronic
938089104 2:128419278-128419300 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
938533869 2:132221332-132221354 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
938533969 2:132221557-132221579 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
938533991 2:132221606-132221628 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
938836260 2:135106106-135106128 CGGGGCGGCTGGCAGGGCGGGGG - Intronic
939186973 2:138872311-138872333 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
940643365 2:156368620-156368642 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
940643469 2:156368844-156368866 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
942150920 2:173075685-173075707 CTCGGCGGGTGCCGGGGCGCGGG + Intronic
942170229 2:173282719-173282741 CTCCGCGCGGGGCAGGGCTCGGG - Intergenic
943297124 2:186154035-186154057 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
943323653 2:186473534-186473556 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
943411817 2:187556947-187556969 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
943906103 2:193502583-193502605 CTCCCCGCCGGGCAGGGCTCCGG - Intergenic
944252467 2:197591688-197591710 CTCCCCGCCGGGCAGGGCTCAGG - Intronic
944451689 2:199850681-199850703 CTCCGCGGGTGGGGAGGCGCGGG - Intronic
944532930 2:200683659-200683681 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
944598621 2:201283245-201283267 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
944598693 2:201283419-201283441 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
944625324 2:201563343-201563365 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
946751212 2:222896549-222896571 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
946751392 2:222896950-222896972 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
948392957 2:237625958-237625980 CTCAGCAGCTGGCAGGCAGCAGG + Intergenic
948480638 2:238248058-238248080 CTCCAGGGCTTGCAGGGTGCAGG + Intronic
948828760 2:240587100-240587122 CTCCGCTCCTCGCAGGGAGCGGG + Intronic
1169085796 20:2824202-2824224 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1169718326 20:8644716-8644738 CGGGGCGGCTGGCAGGGCGGGGG - Intronic
1172051448 20:32121956-32121978 CGGGGCGGCTGGCAGGGCGGGGG + Intronic
1172117011 20:32579024-32579046 CTCCGGGGATGGCAGGGGCCAGG + Intronic
1172717575 20:36976431-36976453 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1174339019 20:49884528-49884550 CTCAGCTGCTGGCAGGGCAGAGG - Intronic
1175252052 20:57615734-57615756 AGCCGCAGCTGCCAGGGCGCAGG - Intronic
1175736652 20:61391880-61391902 CTCCGGGGCCTGCAGGGCTCTGG + Intronic
1175885701 20:62289290-62289312 TGCCGCGGATGTCAGGGCGCAGG - Exonic
1175927841 20:62479815-62479837 CTCCCCGGCTCTCAGGGCCCTGG - Intergenic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1179454099 21:41486659-41486681 CTCTGCAGATGGCAGGGAGCTGG - Intronic
1180943864 22:19679048-19679070 CTCGGAGGCTGGCTGGGCTCAGG - Intergenic
1180962698 22:19769323-19769345 CTCCGTGGCTCACAGGCCGCGGG + Intronic
1181538683 22:23561279-23561301 CGGGGCGGCTGGCTGGGCGCGGG + Intergenic
1181586194 22:23854822-23854844 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1181638346 22:24184542-24184564 CTGCACGGCTGGCATGGCCCTGG + Intronic
1181793044 22:25282780-25282802 CTGCGGCGCTTGCAGGGCGCTGG + Intergenic
1182539054 22:31027466-31027488 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1183722112 22:39568650-39568672 CTCCGAGGCTGGCACGGTGGTGG + Intergenic
1183821054 22:40346408-40346430 CTCCGCAGCCGGCAGCGCCCAGG + Intergenic
1183871645 22:40745384-40745406 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1183995650 22:41631117-41631139 CGGGGCGGCTGGCAGGGCGGGGG + Intronic
1184202826 22:42981787-42981809 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1184244871 22:43230861-43230883 CTCAGGGGCTGGCACGGGGCAGG - Intronic
1184412086 22:44331462-44331484 CCCCGGGGCGGGCAGGGCGGGGG - Intergenic
950729850 3:14947824-14947846 CGGCGCGGAGGGCAGGGCGCGGG - Intronic
954238753 3:49277111-49277133 CACCGCGGCTCCCAGGCCGCTGG + Exonic
954523572 3:51249563-51249585 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
956440321 3:69274398-69274420 CTCCGTAGCTGGCAGGGGGCTGG + Intronic
957970411 3:87375529-87375551 CTCCCTGCCTGGCAGGGCTCAGG + Intergenic
959415250 3:106073815-106073837 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
959415591 3:106074600-106074622 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
960096698 3:113696506-113696528 CTCCGGGGCTGGGGGAGCGCGGG + Exonic
960780454 3:121313368-121313390 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
960780477 3:121313416-121313438 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
961392190 3:126558731-126558753 CCCCGAGGCTGGCAGGGCCCTGG + Exonic
961784452 3:129339867-129339889 CGGGGCGGCTGGCAGGGCGGGGG + Intergenic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
962623060 3:137198516-137198538 CGGGGCGGCTGGCTGGGCGCGGG + Intergenic
962676953 3:137764580-137764602 CCCCGGGGCTGCCTGGGCGCTGG + Exonic
963228782 3:142889080-142889102 ATACGCGGCCGGCAGGGCGGAGG + Exonic
963244738 3:143047728-143047750 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
963498563 3:146097139-146097161 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
966783924 3:183608307-183608329 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
966784080 3:183608658-183608680 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
968426779 4:528984-529006 CTCAGTGGATGGCAGGGCCCGGG - Intronic
968889942 4:3363587-3363609 CTCCACGGCAGGCAGGGCTGTGG - Intronic
969721371 4:8894460-8894482 GGCAGCGCCTGGCAGGGCGCAGG - Intergenic
970409335 4:15791186-15791208 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
970409467 4:15791491-15791513 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
972686808 4:41360420-41360442 CTCAGCAGCCGGCGGGGCGCAGG + Intronic
973142106 4:46781887-46781909 CTCCCCGTGTGGCAGGGCTCAGG + Intronic
974650424 4:64748043-64748065 CACCACGGCTGGCAGGGCAGGGG + Intergenic
975685664 4:76917060-76917082 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG + Intronic
980730078 4:136812644-136812666 CTCCCCTGCTGGCAGGCAGCTGG + Intergenic
980895246 4:138854478-138854500 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
981692021 4:147519846-147519868 TTCAGCTGCTGGCTGGGCGCTGG + Exonic
982040494 4:151391181-151391203 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
982615929 4:157637157-157637179 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
982692790 4:158567128-158567150 CTCCCCGCTTGGCAGGGCTCGGG + Intronic
983238740 4:165207809-165207831 GTCCGCGGCTGGAATGGTGCTGG + Intronic
983296353 4:165873621-165873643 CTCGGAGGCGGGGAGGGCGCAGG - Exonic
983352060 4:166602418-166602440 CTCTGTGGCTGGCAAGGCCCCGG - Intergenic
983652283 4:170046645-170046667 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
984275722 4:177607245-177607267 CTCCCCGGAGGGCAGGGCTCCGG - Intergenic
984803952 4:183736309-183736331 CTGGGCGGCTGGCTGGGCGGGGG + Intergenic
985520760 5:373130-373152 CTGCGCGGTTGGCAGAGTGCTGG + Intronic
989287682 5:39721479-39721501 CTCCTCTGCTGGCAGGGTCCCGG + Intergenic
989587776 5:43087797-43087819 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
989587932 5:43088148-43088170 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
989638117 5:43557188-43557210 GTTCGCGGCTGGCCGGCCGCCGG + Intronic
990426826 5:55696322-55696344 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
992431644 5:76716187-76716209 CTTCGCGGCAGGCAGAGCGCAGG - Exonic
993657545 5:90595188-90595210 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
993657646 5:90595413-90595435 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
994932425 5:106206229-106206251 CTCCCCGCCAGGCAGGGCTCGGG - Intergenic
998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG + Intronic
1002140530 5:177134596-177134618 CTCCGGCGCTGGCTGGGCGCAGG + Intronic
1002205597 5:177560375-177560397 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1002399461 5:178983433-178983455 CTCCGCAGCTGCCAGGTCACGGG - Intronic
1002646435 5:180658837-180658859 CGGAGCGGCAGGCAGGGCGCGGG - Intergenic
1002924063 6:1594765-1594787 CCCCCAGCCTGGCAGGGCGCTGG + Intergenic
1003290466 6:4775668-4775690 CTCCGCGGCAGGCCGGGGGTGGG - Intronic
1003290788 6:4776654-4776676 TCCCGCGGCCGGCCGGGCGCTGG - Exonic
1004883720 6:20032558-20032580 CTCCCCGCCGGGCAGGGCTCCGG + Intergenic
1005063333 6:21796913-21796935 CGCGGCGGCTGGCCGGGCGGGGG + Intergenic
1005069791 6:21851970-21851992 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005644572 6:27827324-27827346 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005688741 6:28281538-28281560 CTCCGCTGCGGGCGCGGCGCAGG + Exonic
1005816005 6:29553477-29553499 CTGCGCGGCAGCCAGAGCGCTGG - Intergenic
1005837337 6:29719025-29719047 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1005933165 6:30498760-30498782 CGGGGCGGCTGGCAGGGCGGGGG + Intergenic
1006021742 6:31121469-31121491 CTCAGCAGATGGCAGGGCTCCGG - Intronic
1006141344 6:31931918-31931940 CGGCGCGGCTGGCCGGGCGGGGG + Intronic
1006391830 6:33763156-33763178 CTCAGAGCCTGGCAGGGCCCCGG + Intergenic
1007674153 6:43580692-43580714 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1008276669 6:49550887-49550909 TTCCGCGGGAGGTAGGGCGCGGG + Exonic
1008567844 6:52786703-52786725 CTCCCCGCCAGGCAGGGCTCAGG + Intergenic
1008624650 6:53305179-53305201 CGGGGCGGCTGGCTGGGCGCGGG + Intronic
1008926539 6:56895007-56895029 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1010030267 6:71266064-71266086 CGCGGCGGCTGGCCGGGCGGGGG + Intergenic
1010239292 6:73601424-73601446 CGGGGCGGCTGGCCGGGCGCGGG - Intronic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1011449024 6:87473214-87473236 CTCCGCGGCTGACTCCGCGCTGG + Intronic
1013366269 6:109440658-109440680 CTCCGCCGCTCGCAGGAGGCGGG + Exonic
1013459039 6:110358073-110358095 CCGCGCGGCTGGCCCGGCGCGGG + Exonic
1014764108 6:125388995-125389017 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1016330539 6:142947581-142947603 CTCCGCCCCGGGCAGGGCGGCGG - Intergenic
1017660752 6:156670554-156670576 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1018295412 6:162339303-162339325 CGGCGCGGCTGGCCGGGCGGGGG - Intronic
1018528135 6:164736200-164736222 CTGGGCGGCTGGCTGGGCGGGGG + Intergenic
1018684895 6:166296735-166296757 CTCCAGGGCTGGCAGGGCAGAGG + Intergenic
1018876522 6:167826856-167826878 CACGGCGGCGGGCGGGGCGCGGG + Intergenic
1019352659 7:562232-562254 CTCCCCGCCTGGCAGGCAGCAGG - Intronic
1019458977 7:1146783-1146805 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1019714923 7:2534273-2534295 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1020105704 7:5421355-5421377 CTCCGCGGCGTGCATGGCGGCGG + Exonic
1021440314 7:20668734-20668756 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1021647434 7:22801137-22801159 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1023044246 7:36197302-36197324 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1025979384 7:66393951-66393973 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1026457418 7:70584777-70584799 CTTCGTGGCTGGCAGGACGAGGG - Intronic
1027373830 7:77533730-77533752 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1027373855 7:77533780-77533802 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1029708284 7:102286716-102286738 CTCCGCGGATGGCCGGGGGCGGG + Intronic
1030819288 7:114076972-114076994 CTTCCCGGCGGGCAGGGCTCGGG - Intergenic
1031972002 7:128071901-128071923 ATCTGCGGCTGGCTGGGCCCAGG + Intronic
1034234141 7:149554707-149554729 CGGCGCGGCTGGCCGGGCGGGGG - Intergenic
1034313631 7:150110892-150110914 CTGCGAGGCTGGCAGGTGGCAGG + Intergenic
1034500603 7:151448322-151448344 CTCCGGGGCTGACCCGGCGCAGG - Intergenic
1034638695 7:152586055-152586077 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1034793267 7:153989904-153989926 CTGCGAGGCTGGCAGGTGGCAGG - Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1038595193 8:28881264-28881286 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1038744802 8:30246910-30246932 CTGGGCGGCTGGCCGGGCGGGGG + Intergenic
1040069853 8:43179911-43179933 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1040818734 8:51534493-51534515 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1046636355 8:116679003-116679025 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1049480040 8:142818278-142818300 CTCCGCGGCTCCCTGGGCCCGGG - Intergenic
1049543170 8:143217804-143217826 CCCAGCTGCTGGCAGGGCCCAGG - Intergenic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1050325046 9:4490474-4490496 CTACCGGGCTGGCAGGGCGGCGG + Exonic
1051641859 9:19230897-19230919 CTGCAAGGCTGGGAGGGCGCGGG + Intronic
1052872931 9:33524779-33524801 CTCCGCGGCTCCCAGGGTCCCGG - Intronic
1053129059 9:35605243-35605265 CTCCGCGGCCTGCCGGGGGCGGG - Intergenic
1055242187 9:74197887-74197909 CGGGGCGGCTGGCAGGGCGGGGG - Intergenic
1057195593 9:93114372-93114394 CTCCGAGGCAGGCAGGGCACAGG + Intergenic
1057758293 9:97853859-97853881 CCCCGCGGCTGTCGGGGGGCGGG - Exonic
1058018959 9:100068217-100068239 CGGGGCGGCTGGCCGGGCGCAGG - Intronic
1058661386 9:107271819-107271841 CGGGGCGGCTGGCCGGGCGCGGG - Intergenic
1059120898 9:111641012-111641034 CGGGGCGGCTGGCCGGGCGCGGG - Intronic
1060682442 9:125577575-125577597 CGGGGCGGCTGGCAGGGCGGGGG - Intronic
1061559715 9:131394444-131394466 CTGCGGGGCTGGGAGGCCGCGGG + Intronic
1061673507 9:132202465-132202487 CTCCGCGGGAGGCAGGGAGGGGG - Intronic
1061808618 9:133149684-133149706 CTCGGCGGATGGCTGGGAGCTGG + Intergenic
1062174983 9:135156629-135156651 CTCAGGTGCTGGCAGGGCCCTGG + Intergenic
1062582948 9:137236446-137236468 CTCCCCGGCTGGGAGGGCTCTGG + Exonic
1062614334 9:137389173-137389195 CTCAGCTGCAGGCAGGGCGGGGG + Intronic
1188367799 X:29334049-29334071 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1189837808 X:45040847-45040869 CTGGGCGGCTGGCCGGGCGGGGG + Intronic
1190779194 X:53578818-53578840 CTGGGCGGCTGGCCGGGCGGGGG - Intronic
1192361965 X:70445859-70445881 CTCTGTGTCTGGCAGGGGGCGGG + Intronic
1192567729 X:72178825-72178847 CTGGGCGGCTGGCCGGGCGGGGG - Intergenic
1196442260 X:115728089-115728111 CGCCGCTGCTGGCCGCGCGCCGG - Intergenic
1197340072 X:125255877-125255899 CTTCCCGCCTGGCAGGGCTCGGG + Intergenic
1197897051 X:131327400-131327422 CTCCCTGGCTGGCCGGGCGGGGG - Intronic
1198321305 X:135521249-135521271 CTCCACGGCTGGCCGGGTCCCGG - Exonic
1199894841 X:152118945-152118967 CACAGGGGCTGGCAGGGTGCAGG + Intergenic
1200292592 X:154886739-154886761 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200339436 X:155382479-155382501 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200347034 X:155458214-155458236 CACCGCGGCGCCCAGGGCGCTGG + Exonic