ID: 903654598

View in Genome Browser
Species Human (GRCh38)
Location 1:24941677-24941699
Sequence CCAAGGGACCAGAGGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903654591_903654598 -4 Left 903654591 1:24941658-24941680 CCAGGGTCCACAGCGGATCCCAA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 903654598 1:24941677-24941699 CCAAGGGACCAGAGGCCAGCAGG 0: 1
1: 0
2: 4
3: 28
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903654598 Original CRISPR CCAAGGGACCAGAGGCCAGC AGG Intronic
900755585 1:4432315-4432337 CCACACGACCACAGGCCAGCAGG - Intergenic
900791339 1:4682997-4683019 CCAAGGGGCCAAGGGCCAACTGG - Intronic
901237234 1:7673622-7673644 CCAAGGGACCAGGAGCCACAAGG + Intronic
901526276 1:9824824-9824846 CCAGGGGTCCAGAGGCGAGGAGG - Intergenic
901875878 1:12166949-12166971 CCAGCGGGCCAGAGGCCAGGCGG - Intergenic
903013352 1:20345668-20345690 ACAAAGGACCACAGACCAGCAGG + Intronic
903466012 1:23553318-23553340 CAAAGGGACCAACTGCCAGCTGG + Intergenic
903654598 1:24941677-24941699 CCAAGGGACCAGAGGCCAGCAGG + Intronic
903676650 1:25068595-25068617 CCAAGGAAACCGAGGCCTGCAGG + Intergenic
904941375 1:34166539-34166561 CCAAGGGGGCAGTGGCCGGCGGG + Intergenic
905228313 1:36494303-36494325 CCAAGTAACTGGAGGCCAGCAGG - Intergenic
905240414 1:36577322-36577344 CCAAGACACCAGAGGCTAGCTGG - Intergenic
905240714 1:36579342-36579364 CTGAGGGAGCAGAGGCCCGCAGG - Intergenic
905887220 1:41497818-41497840 CAAAGGGCCCCCAGGCCAGCTGG - Intergenic
905920268 1:41714612-41714634 CCAGGTGTCCTGAGGCCAGCAGG - Intronic
905957878 1:42014302-42014324 AGAAGGGACCAAAGGCAAGCAGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906804257 1:48764869-48764891 CCAAGCCAGCAGAAGCCAGCAGG - Intronic
907762810 1:57378063-57378085 CAAATGAACCAGAGGCCAGAGGG + Intronic
915722473 1:157994594-157994616 CCAAGGGTCCAGACTGCAGCAGG + Intronic
916312055 1:163408781-163408803 CAAAGGGTCCAGAGGTCACCAGG + Intergenic
917617285 1:176758984-176759006 CCAAGGTCCTAGAGGCCAGCAGG + Intronic
918046454 1:180944491-180944513 CCAGGGGACCACAGTGCAGCTGG + Exonic
922785816 1:228281784-228281806 CACAGGGACCAGACGCCAGGAGG - Intronic
922785826 1:228281817-228281839 CCAAGGGACCAGACCCTAGGAGG - Intronic
923223442 1:231916899-231916921 TCAAGGGACAAGATCCCAGCAGG - Intronic
923721260 1:236468928-236468950 GGAAGGGACCAGAAGCCAGCTGG + Intronic
923879623 1:238089170-238089192 CCAAGGGCCCAGGGCTCAGCTGG - Intergenic
924941892 1:248817885-248817907 CCAAGGAACCAAAGGGGAGCAGG + Intronic
1062948246 10:1476777-1476799 CCAAGTCACCCGAGGCCAGCTGG + Intronic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1067116143 10:43436948-43436970 CCAGCGGACAAGAGGGCAGCTGG + Intronic
1069713535 10:70506388-70506410 CCAGGGGTCCAGAGGTCAACAGG - Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1074117982 10:110471958-110471980 GCATGGGACCAGTGCCCAGCAGG + Intergenic
1074759810 10:116658623-116658645 TTAAGGAACCAGAGGCCATCTGG + Intergenic
1074810613 10:117101417-117101439 CCAAGGGATAAGAGAACAGCTGG + Intronic
1075824588 10:125344530-125344552 CCAAGGGACTTTAGGACAGCAGG - Intergenic
1076374750 10:129975704-129975726 CCAAGGGGGCAGAGGCCTGGAGG + Intergenic
1076426928 10:130373610-130373632 CCAGGAGAGCAGTGGCCAGCAGG - Intergenic
1076554371 10:131311996-131312018 CCAGAGGGCCAGAGGCCACCAGG - Intergenic
1076876350 10:133218099-133218121 CCAAGGCTGCAGAGTCCAGCTGG - Intronic
1077396632 11:2327051-2327073 CCAAGGGAGCAGAGGACACTCGG - Intergenic
1078450929 11:11440321-11440343 CCCAGGGAACAAAAGCCAGCTGG + Intronic
1081167140 11:39820384-39820406 CCACAGGACCAGAGGCCTGGGGG - Intergenic
1081436037 11:43028336-43028358 ACAGGAGATCAGAGGCCAGCAGG + Intergenic
1081912814 11:46710983-46711005 CCAAGGGGCGGGAGGACAGCAGG + Intergenic
1083460393 11:62807202-62807224 GGAAGGGAGCAGAGGCCAGCTGG - Exonic
1083887976 11:65581982-65582004 CTAAGGGACCAGAGGCGACAGGG + Exonic
1084119342 11:67059837-67059859 CCAAGGGGCCAGCAGCCAGGAGG + Intronic
1084547194 11:69820343-69820365 CCCAGGGTCCTGGGGCCAGCAGG + Intergenic
1084806295 11:71581523-71581545 CCAAGGCCCCAGAGGAGAGCGGG + Intronic
1084899881 11:72301711-72301733 GCAAGGGCCCAGAGGCTAGCTGG - Intronic
1085047665 11:73362885-73362907 CCAAGGATCCAGAGGACAGTGGG + Intronic
1085122656 11:73977029-73977051 CCATGGGGTCAGTGGCCAGCGGG + Intronic
1085564467 11:77500889-77500911 CCAGGAGCCCAGAGGCTAGCTGG - Intergenic
1087130848 11:94668288-94668310 GCAAGGGGGCAGAGGCCAGGGGG - Intergenic
1089603356 11:119628041-119628063 CCATGGGTCCAGGAGCCAGCAGG - Intronic
1089966888 11:122660616-122660638 CCCAGAAACCAGAGGTCAGCAGG - Intronic
1090355574 11:126138326-126138348 CCAAGAGACCACAGCCCAGGAGG - Intergenic
1093057192 12:14567469-14567491 CCCAGGAACCAGACGCCCGCTGG + Intronic
1093722568 12:22461916-22461938 CCAAGAGGCCCAAGGCCAGCTGG + Intronic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1096240744 12:49958926-49958948 CCAAGGTACCAGAAGACAGGCGG + Intergenic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096773708 12:53951720-53951742 CCAGTGGCCCAGGGGCCAGCAGG + Intergenic
1098291268 12:68958815-68958837 CCAAGGGATGAGAGGCAGGCGGG - Intronic
1100241404 12:92713492-92713514 CCAAGGTGGCAGAGGCCAGGTGG - Intergenic
1102955050 12:117053793-117053815 ACAGGGGACCAGAGCCCAGGGGG - Intronic
1103443588 12:120980256-120980278 ACCGGGGACCAGAGGCCTGCAGG + Intronic
1103912277 12:124359130-124359152 GCAAAGGGCGAGAGGCCAGCAGG - Intronic
1104592822 12:130098440-130098462 CCAAGGCACCATTGGCAAGCTGG - Intergenic
1106402073 13:29440893-29440915 CCCAGGGACCACAGGCCCTCAGG + Intronic
1106971614 13:35147496-35147518 CCAAGGGAACTGAGCCCTGCTGG - Intronic
1108707460 13:53002603-53002625 CCAAGGGATCATAGGCAAGGAGG - Intergenic
1109726581 13:66349118-66349140 ACAAGGGTCTAGAGGCCTGCTGG + Intronic
1110229449 13:73153156-73153178 CAAAGGGTACAGATGCCAGCTGG - Intergenic
1110643587 13:77854940-77854962 GCAAGGGACAAGAGGGCAGGAGG + Intergenic
1112033227 13:95475599-95475621 CCAGGGGCCCAGAGGCCATTGGG - Intronic
1113523753 13:110958002-110958024 TCAAGGGACCAGGGACCAGGAGG - Intergenic
1114077080 14:19166984-19167006 CCAGGGGACTAGTGTCCAGCTGG - Intergenic
1114269494 14:21092225-21092247 CCAACGGCTCATAGGCCAGCAGG + Exonic
1114534885 14:23416557-23416579 CCAAGGAAACAGAGGCAATCAGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116711550 14:48374234-48374256 ACAAGGGAAAAGAGGACAGCGGG - Intergenic
1118438037 14:65789340-65789362 CCAAAGTACCAGAGACCAGGTGG - Intergenic
1119427311 14:74544076-74544098 CCAAGGGACTTGAAGCCTGCTGG - Intronic
1119482287 14:74965561-74965583 CCAAGGCCCGAGGGGCCAGCTGG - Intergenic
1120173915 14:81273763-81273785 CCCAGGCAGCAGAGGCCAGCAGG - Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121327415 14:93029299-93029321 CCAAGGGTCCAGACCCCAGGTGG - Intronic
1121744826 14:96279864-96279886 TCCAGTGGCCAGAGGCCAGCGGG + Intergenic
1121842238 14:97144266-97144288 CCAAGGAACCAGGGGCAACCAGG - Intergenic
1122147159 14:99698282-99698304 CCAAGGGACCACAGGTCCCCTGG - Intronic
1122644707 14:103186554-103186576 CCAAGGGTCAAGAGGCCAGCGGG + Intergenic
1122856122 14:104561053-104561075 CCCAGCCCCCAGAGGCCAGCAGG + Intronic
1124688004 15:31798767-31798789 CCACGGCCCCAGAGGCCAGAAGG + Intronic
1128240305 15:66096885-66096907 CCAAAGCCCCAGAGACCAGCAGG + Intronic
1129171836 15:73812636-73812658 TGCAGGGACCAGAGGGCAGCTGG - Intergenic
1129412142 15:75355985-75356007 CGAAGGGTCAAGTGGCCAGCAGG + Exonic
1132377321 15:101338137-101338159 GCGAGGGACCACAGGCCACCTGG + Intronic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1132931885 16:2462831-2462853 CCCAGGGACCAGATGCAAGTTGG + Intronic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1134632706 16:15768396-15768418 CCAAGTGACCAGGGGACACCAGG - Intronic
1136092235 16:27928785-27928807 CCAAGAGACCAGACACCAGCCGG + Intronic
1136564403 16:31061433-31061455 CCAAGGGACCAGGAGCCTCCCGG + Exonic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1137677254 16:50309812-50309834 CCCTTGGGCCAGAGGCCAGCTGG - Intronic
1138396045 16:56705539-56705561 CCAGGAGGTCAGAGGCCAGCAGG + Intronic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1139668142 16:68472584-68472606 AGCAGGAACCAGAGGCCAGCTGG + Intergenic
1140573939 16:76141256-76141278 GCAAGTGACCAGAAGCAAGCAGG + Intergenic
1141368099 16:83462894-83462916 CCAATGGCTCAGAGGCCACCAGG - Intronic
1141461850 16:84182440-84182462 CCTGGGGACCAGAGAACAGCAGG + Exonic
1142428091 16:90011367-90011389 CCAAGGGAGCTGAGGCCCGCAGG + Intronic
1144494478 17:15737659-15737681 TCATGGGAACAGAGTCCAGCAGG - Intronic
1144905788 17:18639017-18639039 TCATGGGAACAGAGTCCAGCAGG + Intronic
1145277766 17:21444987-21445009 TCGATGGAGCAGAGGCCAGCTGG + Intergenic
1145315596 17:21730866-21730888 TCGATGGAGCAGAGGCCAGCCGG + Intergenic
1145714034 17:27002805-27002827 TCGATGGAGCAGAGGCCAGCTGG + Intergenic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147363227 17:39944320-39944342 CCACGGGCACTGAGGCCAGCTGG - Exonic
1148151066 17:45396650-45396672 CAAAGGTACCCGAGGCCTGCGGG - Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150303292 17:64063844-64063866 CCAAGGTCTCAGGGGCCAGCCGG + Intronic
1151552711 17:74831254-74831276 CCAGGGTACCAGAGTCCAGGTGG - Intronic
1151700421 17:75739926-75739948 CCAAGTGGTCAGAGGCCATCAGG - Exonic
1152048963 17:77958293-77958315 CCCAGGGACCGGAGGGCAGGCGG + Intergenic
1152519360 17:80846263-80846285 CGAAGGGACCAGAGGCAGGCAGG - Intronic
1153563304 18:6393991-6394013 CGAATGGACCTGAGGCCAGCGGG - Intronic
1155566247 18:27137960-27137982 CCAGAGGACCAGAGGAGAGCAGG - Intronic
1155877062 18:31101490-31101512 GGAAGGTGCCAGAGGCCAGCTGG + Intronic
1157449464 18:47774326-47774348 ACAATGGCACAGAGGCCAGCAGG + Intergenic
1158299465 18:56035248-56035270 ACTAGAGACCAGAGGCCAGAAGG - Intergenic
1160540854 18:79621663-79621685 CCCCGGGATCAGAGGTCAGCCGG - Intergenic
1160817546 19:1043091-1043113 CCGAGGGACCAGCGGCCCCCTGG + Exonic
1160901842 19:1432718-1432740 CCCAGGGTCCTGGGGCCAGCGGG - Intronic
1162966938 19:14160528-14160550 CCCAGGGCCCAGGGCCCAGCGGG - Intronic
1163479817 19:17548453-17548475 CCAAGGGAACAGAGTCTAGGAGG + Intronic
1163845443 19:19635806-19635828 CCAAGGGGTCAGAGGTCAGGAGG + Intronic
1164393697 19:27846215-27846237 CCAAGGGCCTAGAGGCCGGGAGG + Intergenic
1164938069 19:32230335-32230357 CCAAAGGAGCAGATGCCAGCAGG + Intergenic
1165091121 19:33388912-33388934 CCCGGGGACCTGAGGCGAGCAGG - Intronic
1165473035 19:36014372-36014394 CCAATGGCTCAGAGGCCAGGAGG - Intergenic
1166821586 19:45583849-45583871 CCCAGGGACCTGAGGCCAGCAGG - Intronic
1167641726 19:50686271-50686293 CCCAGGGACGCGAGGCCACCGGG + Exonic
1168103643 19:54153908-54153930 GCAAGGGAGCAGAGGCCAGCAGG - Intronic
1168676046 19:58278821-58278843 CCCATTGGCCAGAGGCCAGCGGG + Intronic
926098077 2:10095561-10095583 CAAAAGGCCCAGAGCCCAGCTGG + Intergenic
926117268 2:10221390-10221412 CCCAGGCCTCAGAGGCCAGCGGG + Intergenic
926814274 2:16784811-16784833 CCATTGCACCAGAGTCCAGCAGG - Intergenic
927436618 2:23072028-23072050 CCAAGGGCTCAGAGTCCTGCTGG - Intergenic
928364595 2:30691435-30691457 GCAAAGGACCAGAGGCCTGGAGG + Intergenic
929932001 2:46264639-46264661 CCCAGCCACCAGAGGACAGCTGG + Intergenic
931473560 2:62564861-62564883 TCAAGGAACCAGAGCCCAGAAGG + Intergenic
932262540 2:70338688-70338710 CCTCGGGATCAGAGACCAGCAGG + Intergenic
932470299 2:71950786-71950808 CCAAGGGAGCAGAGGTGAGTGGG - Intergenic
932818452 2:74879948-74879970 GCAAGGGAGCAGTGGCCAGGGGG + Intronic
933977777 2:87525683-87525705 CAAAGGGAGCAAAGGCAAGCAGG + Intergenic
934541053 2:95175424-95175446 CCACGGGACCAGAGGCAGGCAGG - Intronic
936316053 2:111425124-111425146 CAAAGGGAGCAAAGGCAAGCAGG - Intergenic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
936791820 2:116160987-116161009 CCAAGGGAACAGAGCCCTTCTGG - Intergenic
937985014 2:127634514-127634536 CCACTGGACCAGAACCCAGCAGG + Intronic
938296732 2:130183389-130183411 CCCAGGGTGCAGAGGCCTGCGGG + Intronic
938383310 2:130848564-130848586 CCCAGGGACCAGTGGACGGCAGG + Intronic
938460025 2:131491268-131491290 CCCAGGGTGCAGAGGCCTGCGGG - Intronic
940036294 2:149315363-149315385 TCAAGGGAACAGATGCCTGCAGG + Intergenic
944467062 2:200012826-200012848 ACAAGGAACCAGGGGCCAGAGGG - Intergenic
946021820 2:216645410-216645432 CCAAGTGACCAGGTGCCATCTGG + Intronic
946176859 2:217927623-217927645 CCCAGAGACAAGAGGCCATCAGG + Intronic
948216742 2:236237941-236237963 TCCAGGGTCCAGAGGCCTGCGGG + Exonic
948364325 2:237444812-237444834 CAAAGGAACCAGAGGACACCTGG + Intergenic
948573769 2:238936680-238936702 ACTAGGAACCAGAGTCCAGCAGG - Intergenic
948716691 2:239869802-239869824 CCAAGGGACCTGAGGGCACCGGG + Intergenic
948907555 2:240986966-240986988 CCCAGGGAACAGGGGCCAGCAGG + Intronic
1169801514 20:9516272-9516294 CCAAGGGACCTGAGGCGACTTGG + Exonic
1169973901 20:11302039-11302061 CCCAGGCACCTGAGGCCAGGTGG + Intergenic
1170708446 20:18767176-18767198 CCAAGGGAGCAGAGTTCAGTAGG + Intergenic
1170901075 20:20464004-20464026 CATAGGGACCAGAAGCCTGCTGG - Intronic
1172341238 20:34159459-34159481 CCAGGGGACCAGCGCTCAGCAGG - Intergenic
1172484499 20:35290277-35290299 CCATGGGAAGAAAGGCCAGCTGG - Intronic
1172577681 20:36021860-36021882 CCAAGGAACAGGAGGGCAGCTGG + Intronic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1175516644 20:59574526-59574548 CCATGGGAACACAGACCAGCAGG - Intergenic
1176365022 21:6027579-6027601 CCAAGGTACCAGGAGTCAGCTGG + Intergenic
1176708788 21:10133345-10133367 CCAGGGGACTAGTGTCCAGCTGG - Intergenic
1177940414 21:27403337-27403359 CCAAGAGACCAGAGACATGCAGG - Intergenic
1178506937 21:33170140-33170162 CCAAGGGAGCAGAGGAGGGCAGG - Exonic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1179758496 21:43510966-43510988 CCAAGGTACCAGGAGTCAGCTGG - Intergenic
1180864203 22:19106525-19106547 CAAGGAGCCCAGAGGCCAGCCGG + Intronic
1180983185 22:19888977-19888999 CGATGGGACCTGAGGCCAGCAGG - Intronic
1181026527 22:20130811-20130833 CCAGGGGAGCAGGGGCCTGCAGG + Intronic
1181162898 22:20968156-20968178 CCACTGGAGCAGGGGCCAGCTGG - Intronic
1181182879 22:21079595-21079617 CCCAGGGTACAGAGGCCTGCGGG - Intergenic
1182087493 22:27571401-27571423 TCAAGGGAACAGAGGCCACAGGG + Intergenic
1182357260 22:29727832-29727854 CCCAGGGCCCAGATGCCAGGTGG - Intronic
1182437639 22:30340940-30340962 CCAGGGCAGCTGAGGCCAGCCGG + Intronic
1183064212 22:35352518-35352540 CCATGGGACCAGGAGCGAGCAGG + Intergenic
1183437396 22:37803908-37803930 TTAGGGGCCCAGAGGCCAGCAGG - Intergenic
1183716432 22:39535944-39535966 CCCAGGGACCAGTGGCCCCCTGG + Intergenic
1184114161 22:42412535-42412557 CCAAAGGCCAAGAGGCCACCTGG + Intronic
1184600108 22:45538426-45538448 TCAAGGGAGCAGAGCCCAGAAGG - Intronic
1184648307 22:45908008-45908030 CCCAGGGAGCTGAGGCCGGCTGG - Intergenic
1185008950 22:48302389-48302411 CCCCGGAATCAGAGGCCAGCAGG + Intergenic
1185113887 22:48920263-48920285 CGAGGGGACCAGAAGCAAGCAGG - Intergenic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949638550 3:6010725-6010747 CCAAGGTAGCAGGGGCCAACTGG + Intergenic
950095004 3:10323891-10323913 CCAAGGGCCCACAGCTCAGCGGG - Intergenic
950123537 3:10497372-10497394 CCAAGGGCCAAGAGGCATGCTGG - Intronic
950194381 3:10998855-10998877 CTCAGGGACCAGTGCCCAGCAGG - Intronic
950296186 3:11833580-11833602 CGAAGAGCCCAGAGTCCAGCAGG - Intronic
950423311 3:12911149-12911171 CCCAGGCAACAGAGGCCAGAGGG + Intronic
950482213 3:13251115-13251137 GCAAAGGCCCAGAGGCCTGCAGG - Intergenic
951139979 3:19148017-19148039 CCAAGGGAGCAGAGGCAGCCAGG - Intergenic
951663345 3:25095051-25095073 TCACTGGACCAGAGGCCAGAAGG - Intergenic
955470792 3:59283865-59283887 AAAAGGAACCAGAGGCAAGCTGG - Intergenic
957652201 3:83022500-83022522 CCAAGGGATCAGGGGACACCAGG - Intergenic
961106935 3:124250281-124250303 CCAGGAAACCAGAGCCCAGCTGG + Intronic
961385662 3:126522005-126522027 TCCAGGGAGCAGAAGCCAGCAGG - Intergenic
962918209 3:139927771-139927793 TCAAAGGACCAAAGGCCAGTAGG + Intergenic
964404529 3:156335113-156335135 CAAAGGCTCCAGATGCCAGCAGG - Intronic
966942685 3:184756908-184756930 CCAAGGAAACAGAGGCCAGGAGG + Intergenic
967391197 3:188956461-188956483 CCAAGTAGCCAGAGGCCAGCAGG + Intronic
967451257 3:189625924-189625946 GCAAGGGAACAGAGGCCAATTGG - Intergenic
969182266 4:5451386-5451408 ATAAAGGACCTGAGGCCAGCTGG + Intronic
969436793 4:7193279-7193301 ACCAGTGACCAGAGGCCAGTAGG - Intronic
969447447 4:7253348-7253370 GCAATGGACCAGAGGCAGGCAGG - Intronic
969465630 4:7354602-7354624 CAAAAGCACCAGAGGCCATCTGG + Intronic
969673987 4:8604930-8604952 ACCAGGGGCCAGAGGCCACCTGG + Intronic
972352038 4:38244851-38244873 GCAAGGCACCAGAGGCAAGCAGG + Intergenic
977492411 4:97731884-97731906 CAAAGGGACCAGAGGACAAAGGG - Intronic
980135577 4:128855646-128855668 TCAAGGTACCAGAGGGCAGCTGG + Exonic
981041846 4:140230398-140230420 CCAAGGGAACACAGCACAGCTGG - Intergenic
985277385 4:188251125-188251147 CCAAGGGACCACGGCCAAGCTGG + Intergenic
985628274 5:1001463-1001485 CCCAGGGACAGCAGGCCAGCTGG - Intergenic
987062880 5:14259002-14259024 CCAAGGGAGGAGACGCCACCAGG + Intronic
987365324 5:17143426-17143448 CCAAGAAACCAGAGGCCAGTAGG - Intronic
988778381 5:34497329-34497351 CAAAGGGAACAGAGTGCAGCTGG + Intergenic
990227862 5:53676362-53676384 CTATGTGACCAGAGGCCTGCAGG - Intronic
990646952 5:57856031-57856053 CCAAGGAACCAGATGGCAACAGG - Intergenic
992282554 5:75196682-75196704 CCAAAGGACAAGAGGTCAGAGGG + Intronic
997232422 5:132254488-132254510 CCTAGAGACCTGAGGCCACCAGG + Intronic
999090688 5:148933467-148933489 CCAAGGGGCTAGTGGCCAGTTGG - Intronic
999525560 5:152402409-152402431 CCAGGGTACCAGAGGACACCAGG - Intronic
1001299247 5:170522169-170522191 CTCAAGGACCAGAGGTCAGCTGG + Intronic
1002210626 5:177596820-177596842 CAAAGGGCCCAGAGGCCAGAGGG - Intergenic
1002212114 5:177605223-177605245 GCAAGGGACCAGAGGCTTGAGGG - Intronic
1002373156 5:178770345-178770367 CCCAGAGCCCAGAGCCCAGCTGG + Intergenic
1002529822 5:179837650-179837672 CAGAGGGACCCCAGGCCAGCTGG - Exonic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1005124097 6:22426070-22426092 CCAAGAGAGCAGAGACCATCTGG + Intergenic
1005928803 6:30465703-30465725 CCAAGGGAAAGGAGGCCATCCGG - Intergenic
1007572924 6:42906194-42906216 CCAGGGCACCAGAGGCCAAGAGG + Intergenic
1012229822 6:96747690-96747712 CCCAGGGACAAGCAGCCAGCAGG + Intergenic
1013373973 6:109496323-109496345 GCGAGGGACCTGAGGCAAGCAGG - Intronic
1017741298 6:157409176-157409198 CTGAGGGAGAAGAGGCCAGCCGG + Intronic
1017843009 6:158237400-158237422 CCAAGACACCAGAGACCTGCAGG - Intronic
1018908703 6:168089663-168089685 CCCAGGGACCTGAGGACAGACGG - Intergenic
1019154782 6:170031619-170031641 CCAGAGCACCAGAGCCCAGCTGG - Intergenic
1019437928 7:1031464-1031486 CCGGGGGACCAGAGACCTGCAGG + Intronic
1019917714 7:4144241-4144263 GCCAGAGACCTGAGGCCAGCAGG + Intronic
1020005467 7:4781727-4781749 CCAAGAGAACGGAGGCCACCAGG - Exonic
1020381638 7:7554058-7554080 CCAGGGAGCCAGAGGCCAACTGG + Intergenic
1021654801 7:22864452-22864474 GCAAAGGACCAGAGGCCAGCAGG + Intergenic
1022813424 7:33891038-33891060 CCTGGGGACCAGAAGCCATCAGG + Intergenic
1023867350 7:44244488-44244510 CCAAGGGACCCGAGGGCCCCAGG - Intronic
1024562049 7:50653100-50653122 AGAAGGGCACAGAGGCCAGCAGG - Intronic
1024574470 7:50752897-50752919 CCAAGGAACCACAGGCCTGAGGG + Intronic
1025029641 7:55546795-55546817 GCGATGGAGCAGAGGCCAGCAGG + Intronic
1026643855 7:72151109-72151131 ACAAAGGACCACAGGCCAGGTGG + Intronic
1029488393 7:100857010-100857032 CCAGGGAGCCAGAGACCAGCAGG - Exonic
1031840220 7:126728787-126728809 CATAGGGCCCAGAAGCCAGCAGG - Intronic
1032197592 7:129798518-129798540 CCTGGGGACCTGGGGCCAGCTGG + Intergenic
1033221006 7:139526057-139526079 CCCAAGGACCACAGGCCATCAGG - Intronic
1033845135 7:145422506-145422528 CAAAGGGATAGGAGGCCAGCAGG - Intergenic
1034016602 7:147594285-147594307 CCAAGATACCAGAGGGTAGCTGG - Intronic
1035082914 7:156232728-156232750 CAACAGGACCAGAAGCCAGCAGG - Intergenic
1035209045 7:157314235-157314257 CCTGGGGGCCAGAGGCCTGCAGG + Intergenic
1035642017 8:1191009-1191031 CTAAGGGACCTGAGTCCAGCAGG + Intergenic
1037490828 8:19395620-19395642 CCAGGGGACAAGAGGCAAGTTGG + Exonic
1037707468 8:21327184-21327206 CCAATGGAAAAGAGGCAAGCAGG + Intergenic
1039454040 8:37696367-37696389 CCGAGGGATCAGAGCCCACCAGG + Intronic
1040081371 8:43289360-43289382 CTAAGGGACCTGACTCCAGCAGG + Intergenic
1040293767 8:46138768-46138790 CCAAGGAGCCAGAAGCCTGCAGG - Intergenic
1040945529 8:52881158-52881180 CAAAGGCACTGGAGGCCAGCTGG - Intergenic
1041854685 8:62438175-62438197 GGAAGGGACGAGAGGGCAGCTGG - Intronic
1045815207 8:106270463-106270485 CACAGGGGGCAGAGGCCAGCCGG - Intronic
1048327081 8:133448222-133448244 AGAAGGGGCCAGAGGCCACCAGG + Intergenic
1049096921 8:140554105-140554127 CCGAGGGAACAGAAGCCAGCAGG + Intronic
1049168396 8:141141388-141141410 CCAAGGGACCAGGGGGCTGGAGG + Intronic
1049479591 8:142815538-142815560 CAAAGGGATCAGAGAGCAGCTGG + Intergenic
1052280345 9:26725838-26725860 CCCAGAGACCTGATGCCAGCTGG + Intergenic
1052742272 9:32404584-32404606 CTAAGGGGGCAGAGGCCACCTGG - Intronic
1053015183 9:34657731-34657753 CAAAGGGATCAGAGCCCAGGAGG + Intronic
1053019484 9:34685011-34685033 CCAAGGGGCCAGGGGCAGGCAGG - Intergenic
1053645767 9:40118843-40118865 CCAGGGGACTAGTGTCCAGCTGG - Intergenic
1053759944 9:41344666-41344688 CCAGGGGACTAGTGTCCAGCTGG + Intergenic
1054326779 9:63716744-63716766 CCAGGGGACTAGTGTCCAGCTGG - Intergenic
1054538804 9:66257129-66257151 CCAGGGGACTAGTGTCCAGCTGG + Intergenic
1054811829 9:69441240-69441262 CCCAGGCACCAGAGGCCTGCAGG - Intronic
1055603746 9:77947133-77947155 CCAACTCCCCAGAGGCCAGCTGG + Intronic
1055709374 9:79043082-79043104 CCAGGGTTCCAGAGGCCAGCAGG - Intergenic
1056523564 9:87422027-87422049 CCAAGGGAACTGAGGCCCGAAGG - Intergenic
1057521240 9:95762259-95762281 CCAGGTGAACTGAGGCCAGCTGG + Intergenic
1058011825 9:99986708-99986730 CCAATGCAACAGAGACCAGCAGG + Intronic
1060872765 9:127056033-127056055 CCAAGGAATCAGTGGCCAGAAGG - Intronic
1060940982 9:127542662-127542684 TCAGGGCACCTGAGGCCAGCAGG - Intronic
1061147525 9:128808640-128808662 TCAGGGGAGCAGAGGCAAGCGGG - Exonic
1061909615 9:133715779-133715801 CCTAGGGACCAGAAGCCACAGGG - Intronic
1062055325 9:134467026-134467048 ACAAGGGATCCGAGGCCAGTAGG - Intergenic
1062467609 9:136687936-136687958 CCGAGTGACCAGTGGCCACCTGG + Intergenic
1062598135 9:137308199-137308221 CCGAGGGAACACTGGCCAGCAGG + Intronic
1062598405 9:137309392-137309414 AGAAGGGAGCAGAGGCCATCTGG + Intronic
1202793549 9_KI270719v1_random:102315-102337 CCAGGGGACTAGTGTCCAGCTGG - Intergenic
1190196396 X:48323046-48323068 GTAACGGATCAGAGGCCAGCTGG - Intergenic
1192233677 X:69283089-69283111 CCCAGGGATCATAGTCCAGCTGG + Intergenic
1197206862 X:123798326-123798348 CCATGGGAGCAGGGGACAGCGGG - Intergenic
1197209277 X:123815885-123815907 CCATGGGAGCAGGGGACAGCGGG + Intergenic
1198186560 X:134259112-134259134 CCAAGACAGCAGAGGCCAGGTGG - Intergenic
1198551307 X:137748234-137748256 ATAAGGGACCAGAGACCATCAGG - Intergenic
1198937846 X:141917293-141917315 CCAGGGTTCCAGAGGTCAGCAGG + Intergenic
1199500589 X:148501583-148501605 CCAAGGAAGCAGAGGGCTGCTGG - Intronic
1199767646 X:150952746-150952768 CCAAGAGACGAGAGGCTGGCAGG + Intergenic
1199983395 X:152933497-152933519 CCAAGAAGCCAGAGCCCAGCTGG - Intronic
1200208999 X:154337448-154337470 CCAACAGAGCTGAGGCCAGCAGG + Intergenic
1200221877 X:154394680-154394702 CCAACAGAGCTGAGGCCAGCAGG - Intronic
1200696653 Y:6366939-6366961 CCAAGGGACCTCAGGAAAGCTGG - Intergenic
1201037460 Y:9797760-9797782 CCAAGGGACCTCAGGAAAGCTGG + Intergenic