ID: 903654979 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:24943489-24943511 |
| Sequence | CAGTTTCCCCAACTGTAAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4485 | |||
| Summary | {0: 1, 1: 7, 2: 89, 3: 738, 4: 3650} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903654979_903654985 | 22 | Left | 903654979 | 1:24943489-24943511 | CCCACTTACAGTTGGGGAAACTG | 0: 1 1: 7 2: 89 3: 738 4: 3650 |
||
| Right | 903654985 | 1:24943534-24943556 | CTGCCAAACACACAGCTACCAGG | 0: 1 1: 0 2: 0 3: 23 4: 215 |
||||
| 903654979_903654983 | -10 | Left | 903654979 | 1:24943489-24943511 | CCCACTTACAGTTGGGGAAACTG | 0: 1 1: 7 2: 89 3: 738 4: 3650 |
||
| Right | 903654983 | 1:24943502-24943524 | GGGGAAACTGAGGCTCGGCAAGG | 0: 2 1: 10 2: 126 3: 771 4: 3062 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903654979 | Original CRISPR | CAGTTTCCCCAACTGTAAGT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||