ID: 903654979

View in Genome Browser
Species Human (GRCh38)
Location 1:24943489-24943511
Sequence CAGTTTCCCCAACTGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4485
Summary {0: 1, 1: 7, 2: 89, 3: 738, 4: 3650}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903654979_903654985 22 Left 903654979 1:24943489-24943511 CCCACTTACAGTTGGGGAAACTG 0: 1
1: 7
2: 89
3: 738
4: 3650
Right 903654985 1:24943534-24943556 CTGCCAAACACACAGCTACCAGG 0: 1
1: 0
2: 0
3: 23
4: 215
903654979_903654983 -10 Left 903654979 1:24943489-24943511 CCCACTTACAGTTGGGGAAACTG 0: 1
1: 7
2: 89
3: 738
4: 3650
Right 903654983 1:24943502-24943524 GGGGAAACTGAGGCTCGGCAAGG 0: 2
1: 10
2: 126
3: 771
4: 3062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903654979 Original CRISPR CAGTTTCCCCAACTGTAAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr