ID: 903656551

View in Genome Browser
Species Human (GRCh38)
Location 1:24952311-24952333
Sequence GGTGAGATGATGCATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903656551_903656556 30 Left 903656551 1:24952311-24952333 CCTTCCAGATGCATCATCTCACC 0: 1
1: 0
2: 1
3: 14
4: 188
Right 903656556 1:24952364-24952386 TACACTATTTTAGATCTCCATGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903656551 Original CRISPR GGTGAGATGATGCATCTGGA AGG (reversed) Intronic
900528828 1:3142775-3142797 TGTGAGGGGAGGCATCTGGAAGG + Intronic
901864743 1:12097276-12097298 GGAGAGGTGAAGAATCTGGAAGG + Intronic
903656551 1:24952311-24952333 GGTGAGATGATGCATCTGGAAGG - Intronic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
905276344 1:36821019-36821041 GCTGAGAGGACACATCTGGAAGG + Intronic
906289395 1:44610099-44610121 GGTGAGGTAATGAATGTGGACGG + Intronic
909455530 1:75844919-75844941 CGTGGGATGATGCATCAAGAAGG - Intronic
911802333 1:102157807-102157829 GGTGAGCTGAGGCAGGTGGATGG - Intergenic
915905680 1:159875279-159875301 GGAGAGAGGAGACATCTGGAAGG + Intronic
916254699 1:162774828-162774850 GGGGAGGTGTTGCATCAGGACGG + Intronic
916281555 1:163057172-163057194 AGTGACATGAAGCCTCTGGAGGG - Intergenic
916575961 1:166066654-166066676 GATGAGAAAATGCATGTGGAAGG + Intronic
917684052 1:177397786-177397808 TGTGGGATGAACCATCTGGAAGG + Intergenic
917958375 1:180123641-180123663 GGTGTGATGATGCAACAGGTCGG - Intergenic
919048959 1:192488721-192488743 GGAGATATGATGCAACTTGAGGG - Intergenic
919559666 1:199101210-199101232 GCTTAGAGGATGGATCTGGAGGG + Intergenic
920735685 1:208531277-208531299 GTTGATAAGGTGCATCTGGAAGG + Intergenic
922975159 1:229778089-229778111 GGTCAGTGGATGCATCTGCAGGG - Intergenic
1063410088 10:5830916-5830938 GGTGAGAGGTTGCTTCTGGGTGG - Intronic
1064839851 10:19579208-19579230 GTTGAGATATTGCACCTGGAAGG + Intronic
1066200535 10:33139593-33139615 GGGGAGATGATGCATGAGGGGGG - Intergenic
1067659973 10:48227534-48227556 GGAGAGATGTTGGATCTCGAGGG + Intronic
1068057567 10:52029908-52029930 GATGAGATGATATATCAGGAAGG - Intronic
1068690677 10:59910520-59910542 GTTGAGATGTTGCATGTGCAAGG - Intergenic
1069832308 10:71288857-71288879 GATGAGATGATGGATGTGGTGGG - Intronic
1071205014 10:83264526-83264548 GGTGAGATGATACATCAGTGTGG + Intergenic
1071419604 10:85478793-85478815 GATGAGGTGAGGCATCTAGATGG + Intergenic
1072808948 10:98445119-98445141 GGAGAGATGAGGCATCAGGATGG + Intronic
1075096589 10:119475377-119475399 GGTGAGATGTTGCCTGTGCAGGG - Intergenic
1076681184 10:132172221-132172243 GTGGAGATAATGCATCTGGGGGG + Intronic
1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG + Intergenic
1080613442 11:33925315-33925337 GGTGTGCTGATGCATCAGCAGGG + Intergenic
1080766828 11:35305056-35305078 GGAGAAATGGTGAATCTGGATGG - Intronic
1083331903 11:61902624-61902646 GCTGAGAGGATGCATGGGGAGGG + Intronic
1088897682 11:114090543-114090565 GGTGAGAAGATGGTTTTGGAGGG + Intronic
1090404584 11:126469148-126469170 GGTGAGGTCACGCAGCTGGAAGG + Intronic
1091345897 11:134853792-134853814 GCTGAGAAGATGCATCCAGAAGG + Intergenic
1095530092 12:43176747-43176769 GGTTAATTGATGCTTCTGGAAGG + Intergenic
1096415493 12:51408723-51408745 AGAGTGATGTTGCATCTGGAGGG + Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1104915886 12:132264318-132264340 GAGCAGAGGATGCATCTGGAAGG - Intronic
1104965691 12:132507955-132507977 GGTGAGATGCTGCTGCGGGATGG - Intronic
1105262670 13:18791408-18791430 GATGAGATGATTCATGTGGCAGG + Intergenic
1106129469 13:26927570-26927592 TGTGTGTTGATGCACCTGGATGG + Intergenic
1106413063 13:29524480-29524502 GTTTAGAAGATGCTTCTGGAAGG - Intronic
1111197170 13:84889679-84889701 TGTGGGATCATGGATCTGGAAGG + Intergenic
1111899055 13:94178838-94178860 GATGAGATGATGAATCTAAACGG + Intronic
1111913980 13:94342105-94342127 AGTGAGAAGAAGCATCTGGGAGG - Intronic
1116443022 14:44976311-44976333 GGTCAGAGGATGGATATGGAAGG - Intronic
1120561943 14:86005787-86005809 GGTGAGCTGATAAATCTTGAGGG - Intergenic
1121436404 14:93923379-93923401 AGTGAGAAGAGGCATCTGGCAGG - Intronic
1122629241 14:103099720-103099742 GGTGAGCTGAGGGACCTGGAGGG + Intergenic
1123009810 14:105343194-105343216 CGTGATAGGATGGATCTGGAAGG - Intronic
1124867692 15:33509378-33509400 AGTGAGATGCTAAATCTGGATGG - Intronic
1126287782 15:47034294-47034316 GAGGAGATGATGCAACTGTAGGG + Intergenic
1128612879 15:69087964-69087986 GGTGAGATGATGGCTCAGGAGGG + Intergenic
1129619450 15:77130747-77130769 AGTGAGATAATGCATATGAAAGG - Intronic
1129965203 15:79728904-79728926 TGTGAGTTTTTGCATCTGGAAGG + Intergenic
1130346163 15:83047541-83047563 GGTGAGATCTTGCAACTGAATGG + Intronic
1130638361 15:85646755-85646777 TGTGAGCTGATTCATGTGGAAGG - Intronic
1134664376 16:16008022-16008044 GGTGGGAAGGTGCACCTGGACGG + Intronic
1135146823 16:19969838-19969860 GGTTAGAAGAGGCTTCTGGAAGG - Intergenic
1135644366 16:24148514-24148536 GGAAAGTTGATGCATTTGGAAGG + Intronic
1135816849 16:25642428-25642450 GGTTACAGGATGGATCTGGAAGG - Intergenic
1135992870 16:27228500-27228522 GGTGCCGTGATGGATCTGGAGGG - Intronic
1135992890 16:27228556-27228578 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992909 16:27228612-27228634 GGTACCATGATGGATCTGGAGGG - Intronic
1135992928 16:27228668-27228690 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992963 16:27228780-27228802 GGTGCCATGATGGATCTGGAGGG - Intronic
1135992983 16:27228836-27228858 GGTACCATGATGCATCTGGAGGG - Intronic
1136098609 16:27976878-27976900 GGAGAAATGTTGCTTCTGGATGG - Intronic
1138247347 16:55477751-55477773 GGTGAGGGGATGGAGCTGGAGGG - Intronic
1141848697 16:86629381-86629403 GGTGGGAGGAAGCTTCTGGAAGG - Intergenic
1142319215 16:89370299-89370321 GATGAGAAGATGTTTCTGGAAGG + Intronic
1145183744 17:20776005-20776027 GGTGATATGACGCATGTTGAAGG + Intergenic
1146446261 17:32935424-32935446 TGTGAGATGAATCAGCTGGAGGG + Intronic
1148327060 17:46789499-46789521 TATGAGATGATGCAGCAGGAAGG + Intronic
1148535394 17:48434248-48434270 GGAGAGATGATGCATCCTGTCGG + Intergenic
1150479584 17:65499152-65499174 GGTGAGATACTGCCTTTGGAGGG - Intergenic
1150487765 17:65555889-65555911 GTTGAGATGAAGCATCTTAAAGG - Intronic
1150888310 17:69113592-69113614 AGTGAGATTATGCATGGGGAAGG - Intronic
1151884175 17:76913724-76913746 TGTGAGAAGATGCTTCTAGAAGG + Intronic
1152092080 17:78252616-78252638 GGTGTGAGGGTGCAGCTGGAGGG + Intergenic
1153268185 18:3292737-3292759 GATGGGATGATGCATCAAGAAGG - Intergenic
1154428770 18:14292299-14292321 GATGAGATGATTCATGTGGCAGG - Intergenic
1158502522 18:58016203-58016225 GGTGAGGGGTTGCATCTGGCTGG - Intergenic
1159663922 18:71133750-71133772 GGTGACATGATGCATTTCAATGG + Intergenic
1160143024 18:76342360-76342382 AGAGAGATTATGTATCTGGACGG - Intergenic
1161738007 19:6003444-6003466 GGTGAGAGGAGGCAGCTGCAGGG - Intronic
1162044317 19:7988533-7988555 TGGGAGAGGATGCTTCTGGAAGG + Intronic
1162495668 19:11022077-11022099 GGTGAGAGTCTGCATCTGCATGG + Intronic
1168453180 19:56482017-56482039 GCTGATATGATGCTTCTGCATGG + Intergenic
926003900 2:9356660-9356682 GCTGAGAGGCTGCATGTGGATGG + Intronic
926201442 2:10802293-10802315 GATGAGGTGATGCGTGTGGAAGG - Intronic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
926726586 2:16003578-16003600 GGTGAAATGATGCCTCCGGCAGG + Intergenic
930257907 2:49112931-49112953 GGTGGGAGGAAGCAACTGGAGGG + Intronic
931419999 2:62118279-62118301 GATGAGATCATGCATGTGAAAGG + Intronic
931721673 2:65071673-65071695 GCAGAGATGCTGCAGCTGGAAGG - Exonic
932407299 2:71522013-71522035 GGTGGGATAATGCAGCGGGAGGG - Intronic
933637957 2:84727822-84727844 GTTGAGATGATGCGTCAGCAAGG + Exonic
933760376 2:85668298-85668320 GGTGGGATCAAGCACCTGGAGGG - Intronic
935248543 2:101240338-101240360 GGTGAGATAATGCATAAGTAGGG - Intronic
936484407 2:112914110-112914132 GGTCAGAAGAGGCACCTGGAAGG - Intronic
938613844 2:132977441-132977463 TGTGAGAAGATGCATGTGGCAGG - Intronic
941033873 2:160545106-160545128 GGGGAGATGATGCATGTGTGGGG - Intergenic
943645428 2:190404770-190404792 GGTGATATGTTGCATGTGGGAGG - Intergenic
946284819 2:218694972-218694994 GGTGAAATTATGCATTAGGAAGG - Intronic
947734480 2:232447597-232447619 GGGGAGAGGATGGAGCTGGAAGG + Intergenic
948535194 2:238640699-238640721 GTCGGGATGCTGCATCTGGAAGG - Intergenic
948896712 2:240931070-240931092 GGGGAGATGCTGCAGCTGCAGGG + Exonic
1169550542 20:6697417-6697439 GGGCAGAGGATGCATCTGGGGGG - Intergenic
1171363900 20:24610698-24610720 GATGAGCTGATGAGTCTGGAGGG + Intronic
1173013922 20:39208184-39208206 GGGGAGGTGATGAATCTGGAAGG + Intergenic
1173699300 20:45053774-45053796 TGTGAGATGATGCCTCTTGTTGG - Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1174752405 20:53124384-53124406 GCAGTGCTGATGCATCTGGAAGG + Intronic
1176103064 20:63373215-63373237 GGTGAGAAAAGGCCTCTGGACGG + Intronic
1177097020 21:16848975-16848997 GGGCAGATAATGAATCTGGAAGG - Intergenic
1180077983 21:45472863-45472885 CGTGAGAGCATGCATCTGCATGG - Intronic
1181992302 22:26846852-26846874 GGTGAGATAATGAAACTGGGTGG - Intergenic
1182086873 22:27567049-27567071 TGTTAGAGGATGCGTCTGGAGGG - Intergenic
1183889439 22:40914242-40914264 GGGGAAATGGTGCTTCTGGATGG + Exonic
1184494111 22:44827311-44827333 GGTGAGATAATACATTTGGGTGG + Intronic
1185123780 22:48991868-48991890 GGTGAGATGGTGCCTCATGATGG + Intergenic
950136788 3:10586714-10586736 GGTGAGAGGGAGCATCTGGATGG + Intronic
951433185 3:22631886-22631908 TGTGGGATGATGCAGCAGGAAGG - Intergenic
952953306 3:38541709-38541731 GGTGAGATGAGGCTGCTAGAGGG + Intronic
953180018 3:40586156-40586178 GGTGAAATGATGCTGCAGGAGGG - Intergenic
953278869 3:41532374-41532396 GGGGATATGACGTATCTGGATGG - Intronic
954923384 3:54211398-54211420 GGTGAAATGATGTATGTGCAGGG - Intronic
956502790 3:69904882-69904904 TGTGAGATGATGCATATTGTTGG + Intronic
957245335 3:77709341-77709363 CATGAGATGATGCAGCTGGAAGG - Intergenic
959653774 3:108778157-108778179 AGTGATATGATGCATTTGCAGGG - Intergenic
962317695 3:134368989-134369011 GCTGAGATGATGCACCCAGAAGG - Intronic
962482882 3:135812843-135812865 GGTGAGATGAGGCATAAAGAAGG + Intergenic
962830586 3:139135790-139135812 GGTCAAATGATGCAACTGGCAGG - Intronic
965121891 3:164570084-164570106 GGTGAGATGATGTATCTTCGTGG - Intergenic
969418799 4:7077839-7077861 GCTGAGATCATGAACCTGGAGGG - Intergenic
970904220 4:21196478-21196500 GCTAAGATGAGGCATCTGCATGG - Intronic
972723691 4:41726906-41726928 GCTGAGAAGATGCATGTGGTAGG + Intergenic
972981643 4:44711397-44711419 GTTGTGATGATGCATGTGAAAGG - Intronic
973659866 4:53093515-53093537 TGTGAAATAATGTATCTGGAAGG + Intronic
977423622 4:96836686-96836708 AGTGAGAAAATGCATGTGGAAGG + Intergenic
981738287 4:147975539-147975561 CATGAGATGATGCATCAAGAAGG - Intronic
984011973 4:174382179-174382201 GGTGAGCTGATCCAACTGCAGGG + Intergenic
986147676 5:5094566-5094588 CATGAGATGATGCATCAAGAAGG - Intergenic
986275404 5:6270875-6270897 GGTTAGATGAAGCACGTGGATGG - Intergenic
988484164 5:31654623-31654645 CAAGAGATGAAGCATCTGGAAGG - Intronic
992478065 5:77123159-77123181 GTTGAGGGGGTGCATCTGGAGGG + Intergenic
993564620 5:89457925-89457947 GGTGTGATGATGCAAATAGAAGG + Intergenic
997336451 5:133112209-133112231 TGTGAGATGATGCATGCGGAAGG + Intergenic
997823933 5:137089702-137089724 CATGAGATGATGCATCTGATGGG - Intronic
999837834 5:155393529-155393551 GGAGAGATGAAGCAACTGAAAGG - Intergenic
1000420237 5:161030387-161030409 GGGGAGCTGATGCATCTAAAGGG + Intergenic
1001267982 5:170288864-170288886 GGTGAAAGGAGGCATCTGGAAGG + Intronic
1001289249 5:170444880-170444902 GGTGGGCTGAGGCAGCTGGAGGG - Intronic
1003050649 6:2778009-2778031 GGTGAGATGAGGCATCTTTAAGG + Intronic
1003528700 6:6919992-6920014 GGTGAGGAGATGCCGCTGGAAGG - Intergenic
1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG + Intergenic
1013272149 6:108555415-108555437 GTTACGATGATGCATTTGGAGGG - Intergenic
1014756557 6:125307953-125307975 AGTGATATTATGCATCTGGGAGG + Intergenic
1016617812 6:146073194-146073216 GGAGAAATGATGGATCTGTAGGG + Intronic
1020983797 7:15107153-15107175 GGCAACATGATGAATCTGGAAGG - Intergenic
1022465257 7:30649202-30649224 CGTGTGCTGATGCAGCTGGACGG - Intergenic
1024233007 7:47377133-47377155 GGTGAATTGATTCAGCTGGACGG - Intronic
1027050540 7:75018794-75018816 GGTGAGATGGAGAATCAGGACGG + Intronic
1028770763 7:94618149-94618171 AGTGAGATAATGCATTTGAAAGG - Intronic
1029449267 7:100631861-100631883 GGCCTGATGATGCAACTGGAGGG + Exonic
1030128657 7:106178640-106178662 GGAGAGGAGATGCATGTGGAGGG + Intergenic
1030617878 7:111757152-111757174 GTGGAGATGAGGCTTCTGGAGGG + Intronic
1030626981 7:111855093-111855115 GATGAGATGAGGCAGGTGGACGG + Intronic
1032116190 7:129119431-129119453 AGTGAGATGATACTTCTTGATGG + Intergenic
1033667839 7:143459867-143459889 GGTGAGAAGATACATCTGGAAGG - Intergenic
1034936285 7:155202903-155202925 GGTGAGAAGAGGCTTCTGGGAGG + Intergenic
1035531473 8:355237-355259 AGTCAAATGAGGCATCTGGAGGG - Intergenic
1037292002 8:17360890-17360912 CGTGAGATGAAGGGTCTGGAAGG + Intronic
1037463926 8:19140424-19140446 CATGAGATGATGCAGCAGGAAGG + Intergenic
1039582734 8:38680289-38680311 GGACAAATGATGCAACTGGAAGG + Intergenic
1041067309 8:54094374-54094396 TGTGAGCTGGTGCAACTGGAGGG + Intronic
1043402837 8:79900739-79900761 GGTCAGATGCTGCAGCTTGATGG + Intergenic
1044459751 8:92430100-92430122 GGTGATATGATGTGTCTTGAAGG - Intergenic
1045866883 8:106877205-106877227 TGTCTGATGATACATCTGGATGG - Intergenic
1046891449 8:119426244-119426266 TGGGAGATGATGTATCTGCAGGG + Intergenic
1047958251 8:129992179-129992201 GGTGTGATGATGCATGTCTATGG + Intronic
1048270189 8:133022150-133022172 GGTGAGTTGCTGCCTCTGGTGGG + Exonic
1048375795 8:133821510-133821532 GGTGAGATGACCCATATGCAGGG + Intergenic
1053870865 9:42490471-42490493 GTTGTGCTCATGCATCTGGAAGG - Intergenic
1054085430 9:60738646-60738668 GTTGTGCTCATGCATCTGGAAGG + Intergenic
1057144460 9:92748886-92748908 GGTGAGATGATTCATCTGAGTGG + Intronic
1058573572 9:106375043-106375065 AGGGAGATTATGCATGTGGAGGG - Intergenic
1058778450 9:108309221-108309243 TGTGAGATGATGTTTCTGGTAGG + Intergenic
1060397463 9:123326226-123326248 GGTGAGAGGAGGTTTCTGGATGG - Intergenic
1061084488 9:128391145-128391167 GGTGGGATGATGCTTTTGGTGGG - Exonic
1062047006 9:134429009-134429031 GGTGACATGCTGCCTCTGTAGGG + Intronic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1186604400 X:11075171-11075193 GAATAGATGATGCATTTGGAAGG + Intergenic
1186944283 X:14548089-14548111 AATGAGATGATACATATGGAGGG - Intronic
1187332301 X:18352046-18352068 GGTGATAGGAAGCATCTGGGAGG + Intronic
1190740890 X:53288124-53288146 TGGGAGGTGATGCAGCTGGATGG + Intronic
1196861783 X:120035568-120035590 GTTAAGAACATGCATCTGGAAGG - Intergenic
1198442977 X:136682682-136682704 GTGGAGATATTGCATCTGGATGG + Intronic
1198840028 X:140846606-140846628 CATGGGATGATGCATCAGGAAGG - Intergenic
1201629109 Y:16049626-16049648 GATGAGATCATGTATTTGGAAGG + Intergenic