ID: 903656835

View in Genome Browser
Species Human (GRCh38)
Location 1:24954694-24954716
Sequence TCCGTGGATGGCCACGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903656835_903656842 20 Left 903656835 1:24954694-24954716 CCACGGACGTGGCCATCCACGGA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 903656842 1:24954737-24954759 CAAGTGTGCTTCGGCTGCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 91
903656835_903656840 11 Left 903656835 1:24954694-24954716 CCACGGACGTGGCCATCCACGGA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 903656840 1:24954728-24954750 GCCTCAGAGCAAGTGTGCTTCGG 0: 1
1: 0
2: 0
3: 46
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903656835 Original CRISPR TCCGTGGATGGCCACGTCCG TGG (reversed) Intronic
900146003 1:1158885-1158907 TCCGTGGATGGCCAGTTCTGAGG - Intergenic
902476901 1:16693158-16693180 TCCGCGGAAGGCCCGGTCCGAGG + Intergenic
903656835 1:24954694-24954716 TCCGTGGATGGCCACGTCCGTGG - Intronic
907299444 1:53477386-53477408 TCCGTGGATGCCCAGGTTCCAGG + Intergenic
914921137 1:151848111-151848133 GCCGAGGATGGCCACTTCCAGGG + Intronic
1065318909 10:24490863-24490885 TCCCTGGATGGCCTCGTTCAGGG - Intronic
1077044785 11:539974-539996 TCCGTGGATAGTCAGGTCCTGGG + Intronic
1085463745 11:76710491-76710513 TCTGTGGAGGGCCAGGTCCCTGG + Intergenic
1090232010 11:125114098-125114120 TCTGTGGAGAGCAACGTCCGTGG + Intergenic
1105214049 13:18274095-18274117 TCTGGGGGTGGCCACCTCCGAGG + Intergenic
1125003239 15:34793279-34793301 TGCCTGGATGGCCACGTACATGG + Exonic
1132565951 16:623066-623088 TCCTGGGATGGCCATGTCTGAGG - Intronic
1138474656 16:57263684-57263706 GCCCAGGATGGCCACATCCGAGG - Intronic
1138533165 16:57646062-57646084 GCAGTGGATGGCCAGGTTCGTGG + Intronic
1151632524 17:75320595-75320617 TCTGTGACTGGCCACCTCCGAGG + Intronic
1151891699 17:76954774-76954796 TCCCTGGACGGCCACCTCCCAGG + Intergenic
1152717870 17:81908534-81908556 TCCCTGGATGGCCAGGCCCGCGG + Intronic
1202710916 1_KI270714v1_random:18984-19006 TCCGCGGAAGGCCCGGTCCGAGG + Intergenic
925206190 2:2008299-2008321 TGCGAGGCTGGCCACGCCCGTGG - Intronic
931817694 2:65920960-65920982 TCCATGGAAGGCCAGCTCCGTGG - Intergenic
944229598 2:197379257-197379279 TCAGTGTATGGCCAGGTCAGAGG + Intergenic
945514309 2:210743781-210743803 TCTGTGGATGGACAGGTCCTTGG + Intergenic
1174080228 20:47965868-47965890 TCTGTGCATGGCCACGTTCAAGG - Intergenic
1174131007 20:48343269-48343291 CCCGTGGCTTGCCACGGCCGTGG + Intergenic
1175911490 20:62407261-62407283 TCTGAGGATGGCCGCGGCCGCGG - Exonic
1176413177 21:6459684-6459706 TCTGTGGCTGGCCTCGTCCTGGG - Intergenic
1178270503 21:31184890-31184912 TCCATGCATAGCCAAGTCCGCGG + Intronic
1179688673 21:43068006-43068028 TCTGTGGCTGGCCTCGTCCTGGG - Intronic
1181698626 22:24607785-24607807 TCTGGGGGTGGCCACCTCCGAGG - Intronic
1183334449 22:37238675-37238697 TCTGTGGATGGCCCCGTGCTAGG - Intronic
1183736593 22:39648083-39648105 GCCGTGGACGGCCACGTGCTGGG - Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
969298799 4:6285256-6285278 TCCCTGGATGTCCCCGTCCCTGG - Intronic
1001692315 5:173642339-173642361 GCTGTGGATGGCCAGGTCAGAGG + Intergenic
1004223598 6:13767560-13767582 TCCGTGGATGCCAACGTTTGCGG + Intergenic
1006543290 6:34757853-34757875 TCCGTGGATGGGCATCTCAGTGG + Intronic
1019820560 7:3239690-3239712 TCTGTGGATGGACACGTGAGGGG - Intergenic
1020431033 7:8116379-8116401 CCAGTTGATGGCCACATCCGTGG + Intronic
1023610415 7:41965955-41965977 CCCGGCGATGGCCACGTCCGCGG - Exonic
1034681303 7:152930417-152930439 TCTGTGGATGGACACGTAGGTGG + Intergenic
1034685886 7:152971083-152971105 TGTGTGGATGGCCACTTCTGTGG - Intergenic
1035828409 8:2668803-2668825 TCTCAGGATGGCCACGTCCCTGG + Intergenic
1055090912 9:72364568-72364590 GCCGCGGATGGCGGCGTCCGGGG - Exonic
1194400131 X:93431752-93431774 TCCCTGAATGGCCACGTTTGTGG - Intergenic
1200233564 X:154458057-154458079 TCGCTCGATGGCCGCGTCCGCGG - Intergenic