ID: 903657743

View in Genome Browser
Species Human (GRCh38)
Location 1:24959404-24959426
Sequence CCCTTTGATGGCGGCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903657743_903657757 29 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657757 1:24959456-24959478 CATAGTGGGCACGGAAGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 165
903657743_903657747 -8 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657747 1:24959419-24959441 TCAAAGGGACCTAGCAGACGTGG 0: 1
1: 0
2: 0
3: 7
4: 78
903657743_903657751 15 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657751 1:24959442-24959464 CGCCAGGCAAGCGCCATAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 42
903657743_903657750 14 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657750 1:24959441-24959463 GCGCCAGGCAAGCGCCATAGTGG 0: 1
1: 0
2: 0
3: 2
4: 51
903657743_903657755 25 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657755 1:24959452-24959474 GCGCCATAGTGGGCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 39
903657743_903657753 20 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657743_903657748 -1 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657748 1:24959426-24959448 GACCTAGCAGACGTGGCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
903657743_903657754 24 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657754 1:24959451-24959473 AGCGCCATAGTGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903657743 Original CRISPR CCCTTTGATGGCGGCTTCTG AGG (reversed) Intronic
902404938 1:16177444-16177466 CCCCTTGGTGGTGGCATCTGGGG - Intergenic
902686186 1:18079227-18079249 CCCTTTGCTGGCAGATTCTGGGG - Intergenic
903071395 1:20728582-20728604 CTCTTTGATGGCGCCCTCTCAGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
903939895 1:26922208-26922230 CACTTTGATGGCGGCTTCCAAGG + Intronic
908655683 1:66385766-66385788 CCCTTTTATGGAGACTTCAGTGG - Intergenic
914459710 1:147872150-147872172 CCCTTTGCTGGCAGCATCAGGGG - Intergenic
918125617 1:181580817-181580839 ACCCTGGATGGAGGCTTCTGTGG + Intronic
1073546396 10:104353284-104353306 CCCTTTGAAGACAGCGTCTGTGG + Intergenic
1076615622 10:131752287-131752309 CCCACTGAAGGGGGCTTCTGGGG - Intergenic
1076732634 10:132446244-132446266 CCCTGTGATGGCGGCTGCCATGG - Intronic
1076741256 10:132486850-132486872 CCCTGGGATGTCGGCTTTTGGGG + Intergenic
1077598780 11:3557792-3557814 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
1084890774 11:72235910-72235932 CCCGTTGGTGGCGGTTTCTCTGG - Exonic
1085018887 11:73192629-73192651 CCCTTGGCTGGGGGCTTCTTAGG - Intergenic
1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG + Intronic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1090567228 11:128007457-128007479 ACCTTTGAATGGGGCTTCTGTGG - Intergenic
1091223640 11:133945369-133945391 ATCTTTGCTGGTGGCTTCTGAGG - Intronic
1096778826 12:53980263-53980285 CCCTCTAATGGCGACTGCTGGGG + Intergenic
1104944721 12:132410467-132410489 CCGTGTTAAGGCGGCTTCTGAGG - Intergenic
1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG + Intergenic
1107207370 13:37808900-37808922 CACTTAGATGGCGGTTTCAGGGG - Intronic
1113604731 13:111597240-111597262 CCCTTTGTTGGCCGTCTCTGGGG + Intronic
1113760935 13:112846094-112846116 CCCTTTTCTGGCTGCTTTTGAGG + Intronic
1115435025 14:33362644-33362666 CCCTTAGATGGAGGATTCAGAGG + Intronic
1118872145 14:69752407-69752429 CCCTTTGTTTGGGGCCTCTGAGG + Intronic
1121792952 14:96712559-96712581 CCCTTTGATAGCGGCATGAGTGG - Intergenic
1123981805 15:25611765-25611787 CTCATTGCTGGCTGCTTCTGGGG + Intergenic
1129253242 15:74320008-74320030 CCCTGGGAGGGCAGCTTCTGTGG + Intronic
1131562915 15:93459809-93459831 ACCTTATATGGCGGCTGCTGAGG + Intergenic
1133373322 16:5262893-5262915 CCCTTTGATGCCCCCTTCAGTGG - Intergenic
1134916119 16:18072465-18072487 CCCTTTGATGGAAGACTCTGTGG - Intergenic
1139824313 16:69745157-69745179 CCCTTTGCTGACAGCTTCAGTGG - Intronic
1142711322 17:1725329-1725351 CCCTTTGAGGACGGGTCCTGCGG + Exonic
1143489802 17:7279628-7279650 CACTTTGTTTCCGGCTTCTGGGG - Intergenic
1147351032 17:39844117-39844139 CCATTTGATGGGGTCTACTGTGG + Intronic
1149229592 17:54518322-54518344 CCCTTGGATGGGGGTTTGTGGGG + Intergenic
1149359839 17:55883596-55883618 ACCTTAGATGACGGCTTCAGTGG - Intergenic
1151349843 17:73525246-73525268 CCCCTCGAGGGCTGCTTCTGGGG - Intronic
1152121362 17:78420521-78420543 CCTTTGGATGGTGGCTTGTGGGG + Intronic
1155270697 18:24139058-24139080 CCCCTTGCCGGCGGCTCCTGAGG - Exonic
1155702332 18:28762315-28762337 CCCTTTGCTGGCAGCTTCCCTGG - Intergenic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1161933611 19:7357446-7357468 CCCTTTTATGGCTGATGCTGTGG + Intronic
1162652013 19:12095912-12095934 TACTTTGGTGGTGGCTTCTGTGG + Intronic
1163592605 19:18202972-18202994 CCCCTTGAAGGGGGCTGCTGGGG - Intronic
1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG + Intergenic
925290741 2:2746911-2746933 CCCATTGCGGGCTGCTTCTGTGG + Intergenic
925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG + Intergenic
926117662 2:10223609-10223631 CTCTGTGGTGGGGGCTTCTGGGG + Intergenic
928810758 2:35222030-35222052 CCCTTTGATGGAAAATTCTGTGG + Intergenic
932560418 2:72862843-72862865 TGCTTTCTTGGCGGCTTCTGGGG + Intergenic
936460267 2:112709162-112709184 CCCTCGGAGGGCGGCTCCTGGGG - Intergenic
937040963 2:118820325-118820347 CCCTTTGCTGGTGACTCCTGGGG + Intergenic
937502021 2:122489496-122489518 CCCTTTTCTGGTGGATTCTGTGG + Intergenic
943753904 2:191538443-191538465 CCCTATGATGGCACCTACTGTGG - Intergenic
944866071 2:203863373-203863395 CCCTGTCAGGGTGGCTTCTGAGG - Intergenic
945322513 2:208441430-208441452 CCCTTTTATGGAGGCTTCATTGG + Intronic
947820903 2:233068837-233068859 CCCTGTGACGGAGGCTGCTGGGG + Intronic
1169087686 20:2837643-2837665 GCCTTTGGTGGAGGCTTCTGAGG - Intronic
1176097713 20:63351975-63351997 CCCATTGGTGGGGACTTCTGTGG - Intronic
1177511257 21:22091186-22091208 CCCTTTGATGGGGTTTTTTGGGG + Intergenic
1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG + Intronic
1180216630 21:46327683-46327705 CCCTTTGATGGGTGTTTCTTGGG + Intronic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1181726814 22:24817112-24817134 CCCTTTGATGTGGACATCTGTGG - Intronic
1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950751677 3:15134061-15134083 CCCTTTGATGCCTCCTTCAGTGG - Intergenic
952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG + Intergenic
954346001 3:49999927-49999949 ACCTCTGATGGTGACTTCTGTGG + Intronic
956710474 3:72034823-72034845 CCCAGAGATGGCAGCTTCTGGGG + Intergenic
957068930 3:75550247-75550269 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
961284478 3:125790089-125790111 CCCTTTGATGCCCACTTCGGTGG - Intergenic
963104497 3:141635184-141635206 CTCTTTGGTTTCGGCTTCTGAGG - Intergenic
968525773 4:1055993-1056015 GCCTGTGATGCCGGCTTCAGCGG - Intergenic
969799927 4:9555847-9555869 CCCTTTGATGTCCCCTTCAGTGG - Intergenic
977679279 4:99781124-99781146 CCCTTTAATGGCATATTCTGAGG - Intergenic
977859809 4:101943366-101943388 CCATTAGATGACTGCTTCTGAGG + Intronic
987403530 5:17502287-17502309 CCTTTTGCTGGCGGCTTTAGTGG + Intergenic
987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG + Intergenic
987866575 5:23547864-23547886 CCCTTTTATTCTGGCTTCTGTGG + Intergenic
991723908 5:69517138-69517160 CCCTGTGATGTCAGTTTCTGAGG - Intronic
992192863 5:74311198-74311220 CCCTTTCATGCAGGCTTTTGTGG - Intergenic
995213930 5:109573146-109573168 CTCTTGGAAGGAGGCTTCTGAGG + Intergenic
998870187 5:146544131-146544153 CCCTGTGATGGAGGAGTCTGGGG - Intergenic
1002660016 5:180785509-180785531 CCCCTTGCTGGAGGGTTCTGGGG - Intergenic
1007075902 6:39065905-39065927 GGCTTTGATGGGGGCATCTGTGG + Intronic
1011044343 6:83065703-83065725 GCCTGCCATGGCGGCTTCTGCGG - Exonic
1013191998 6:107811563-107811585 CCTTTTGATGGGGGCATTTGGGG - Intronic
1019274894 7:171094-171116 CCTTTTGCTGGCGTCCTCTGGGG + Intergenic
1019526968 7:1484871-1484893 CCCTGGGCTGGCGGCTTCTTGGG - Intronic
1020361817 7:7335051-7335073 CTCCTGGATGGCGGGTTCTGTGG - Intergenic
1022094627 7:27130885-27130907 AACTTTGGTGGCGGCGTCTGCGG - Intronic
1023743774 7:43303343-43303365 CCCTTTGATGGCAGGTGTTGGGG - Intronic
1024056517 7:45662996-45663018 CCCTTTGATGGCTCCTGCAGTGG - Intronic
1024308145 7:47945381-47945403 CCCTCTGGTGGCGGCTTCTTGGG - Intronic
1024564624 7:50671261-50671283 GCCTATGATGGGGGTTTCTGAGG - Intronic
1026887817 7:73964753-73964775 CCCTCTGATTGGGGCTTCTCAGG - Intergenic
1027241933 7:76336339-76336361 CCCTCTGGTGGGGGCTGCTGAGG + Intronic
1033220129 7:139522303-139522325 CCCTTAGAAGGCTGCTGCTGTGG + Intergenic
1035325042 7:158060364-158060386 ACCTGTGATGGCGGCCGCTGGGG - Intronic
1036131257 8:6115896-6115918 CACTTTTCTGTCGGCTTCTGTGG - Intergenic
1036255006 8:7198890-7198912 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1054813748 9:69455347-69455369 CCCCTGGGAGGCGGCTTCTGAGG + Intronic
1056808701 9:89747702-89747724 CCATTTGCTGCTGGCTTCTGTGG + Intergenic
1060819911 9:126655285-126655307 CCCTTCGATGAGGGCATCTGAGG + Intronic
1199862041 X:151809878-151809900 GCCTTTGACTGCAGCTTCTGAGG - Intergenic