ID: 903657745

View in Genome Browser
Species Human (GRCh38)
Location 1:24959413-24959435
Sequence CTGCTAGGTCCCTTTGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903657745_903657748 -10 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657748 1:24959426-24959448 GACCTAGCAGACGTGGCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
903657745_903657751 6 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657751 1:24959442-24959464 CGCCAGGCAAGCGCCATAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 42
903657745_903657753 11 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657745_903657758 23 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657758 1:24959459-24959481 AGTGGGCACGGAAGGGCTGGCGG 0: 1
1: 0
2: 5
3: 41
4: 351
903657745_903657757 20 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657757 1:24959456-24959478 CATAGTGGGCACGGAAGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 165
903657745_903657750 5 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657750 1:24959441-24959463 GCGCCAGGCAAGCGCCATAGTGG 0: 1
1: 0
2: 0
3: 2
4: 51
903657745_903657754 15 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657754 1:24959451-24959473 AGCGCCATAGTGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 58
903657745_903657755 16 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657755 1:24959452-24959474 GCGCCATAGTGGGCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903657745 Original CRISPR CTGCTAGGTCCCTTTGATGG CGG (reversed) Intronic
903657745 1:24959413-24959435 CTGCTAGGTCCCTTTGATGGCGG - Intronic
904429302 1:30451733-30451755 CTGCAAGGTCGCTTGGCTGGTGG + Intergenic
904756333 1:32770697-32770719 CTGCTAAGCCCCGCTGATGGAGG - Exonic
905972288 1:42151160-42151182 CCGCTATGTCCCATTGATGTGGG + Intergenic
912389813 1:109295179-109295201 AAGCCGGGTCCCTTTGATGGAGG - Exonic
920337449 1:205254685-205254707 CTGCCAGGTGCCTGTGTTGGGGG + Intronic
1064081214 10:12309332-12309354 GTGCTGGCTCCCTTTGAAGGAGG + Intergenic
1066632234 10:37468703-37468725 GTACTGGGTCCCTTTGAAGGAGG + Intergenic
1067535048 10:47102901-47102923 CTGCAAGGCCCCTTTGATTCTGG - Intergenic
1073889230 10:108079219-108079241 TTGCAAGGTCCCATTTATGGAGG + Intergenic
1112752353 13:102596386-102596408 TTGTTATGCCCCTTTGATGGGGG - Intergenic
1117898370 14:60509932-60509954 CCGCTCGGTCCCTTTGTCGGCGG - Exonic
1119406998 14:74405301-74405323 CCTCTAGGTCACTTGGATGGAGG - Intergenic
1122598353 14:102908592-102908614 CTGCCAGGGCCCTGTGATGCGGG - Exonic
1123818497 15:24002931-24002953 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1123847160 15:24314258-24314280 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1123866158 15:24521325-24521347 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1124882891 15:33658747-33658769 TTACTTGCTCCCTTTGATGGAGG - Intronic
1127680615 15:61293409-61293431 CTGCTGGGTCTCTCTTATGGGGG - Intergenic
1135232513 16:20722693-20722715 CTGCAAGTTACCTTTCATGGTGG - Intronic
1137010586 16:35316365-35316387 CTGTGATGTCCCTGTGATGGGGG + Intergenic
1150270020 17:63857921-63857943 CTTCTACTTCCCTTTGATGTAGG + Intergenic
1151398462 17:73840459-73840481 TTGCTAGGCTGCTTTGATGGGGG - Intergenic
1153215776 18:2819563-2819585 GTACCAAGTCCCTTTGATGGGGG + Intergenic
1153660233 18:7319522-7319544 CTGCTGGGTCACTGTGATGATGG - Intergenic
1161646341 19:5455654-5455676 CTGCTAGGTCCCACTGGAGGCGG - Exonic
1163207597 19:15815001-15815023 GAGGTAGGTCCCTTGGATGGGGG - Intergenic
1165184062 19:34001753-34001775 CTTCCAGGTCCCTCTGATGATGG - Intergenic
925375619 2:3382526-3382548 CTGCTAGATACCTATCATGGAGG - Intronic
925935585 2:8755744-8755766 ATGCCAAGTCCATTTGATGGGGG - Intronic
926168181 2:10534626-10534648 CTTCTAGGTCCCATTGAGGGCGG + Intergenic
926426766 2:12745331-12745353 ATCCTAGGTCCCTTTCATTGTGG + Intergenic
926742737 2:16125942-16125964 GTGCAAGGTCCCTGTGGTGGAGG - Intergenic
927488486 2:23505177-23505199 CTGCTAGGGGCCTTTGCAGGTGG + Intronic
928443005 2:31309041-31309063 CTGTTAGGTCCATTTGTTCGAGG + Intergenic
929913640 2:46115298-46115320 CTGCCAGGTCCCTGTGAAGCAGG + Intronic
936374253 2:111927229-111927251 CTCCCAGGCCCCTTTGATGTTGG - Intronic
936980857 2:118263933-118263955 CTGCTACAGGCCTTTGATGGTGG - Intergenic
938310140 2:130284286-130284308 CTGAGAGGTCCCTTGGCTGGAGG + Intergenic
938444780 2:131368083-131368105 CTGAGAGGTCCCTTGGCTGGAGG - Intergenic
944027560 2:195189875-195189897 CTTCTAGGTCCATTTGGTTGAGG - Intergenic
944485731 2:200203008-200203030 CTGTTAAGTCCATTTGTTGGAGG - Intergenic
946547967 2:220766448-220766470 CTGCTAAGCCCCTTTGATGATGG + Intergenic
947472696 2:230413125-230413147 CTTCTACGTCCCTTGGAGGGTGG + Intergenic
948610464 2:239163380-239163402 CTGCTCGGTCCCTCTGCAGGGGG + Intronic
1170733003 20:18990271-18990293 CTGCTAGGCCCCTGGGAGGGAGG - Intergenic
1171442858 20:25179549-25179571 CTGCCAGTTCCCTTTCCTGGAGG - Intergenic
1176714210 21:10336036-10336058 CTGCTAGGGATCTTTGATGAAGG - Intergenic
1183163997 22:36133736-36133758 CTGTGAGGTCCCTTTTATGATGG + Intergenic
1183170266 22:36182691-36182713 CTGCAAGGTCCCTTTTATGATGG + Intergenic
1183311900 22:37114535-37114557 CAGCCTGGTCTCTTTGATGGGGG + Intergenic
1183407764 22:37639005-37639027 CTGCCAGCTCCCTTTAAGGGAGG - Intronic
1184242790 22:43220273-43220295 CTGCCAGCTCCCTTTGCTTGTGG + Intronic
1184829657 22:46976409-46976431 CTGCCAAGTCCCCTGGATGGTGG - Intronic
952039697 3:29247284-29247306 CTGCTGGGTGACTGTGATGGTGG - Intergenic
952209186 3:31212314-31212336 TTGCTAGATCCCTTTGTTTGTGG + Intergenic
963446513 3:145416361-145416383 CTGATAGGTCCCTTTGGTCTAGG + Intergenic
964820454 3:160763193-160763215 CTGCTTGCTCCCTTTGCAGGTGG + Intronic
965411538 3:168337822-168337844 CTGCCAAATCACTTTGATGGTGG - Intergenic
969600694 4:8174249-8174271 GTGCCAGCTCCCTTTTATGGAGG - Intergenic
972744333 4:41918708-41918730 CTCGAATGTCCCTTTGATGGAGG + Intergenic
978201780 4:106030882-106030904 CTGCTAAGTCCATTTGTTGTAGG + Intergenic
986204292 5:5609524-5609546 CTGCTTGATCTCTTTGATGTAGG + Intergenic
994311473 5:98277134-98277156 CTGCTAGGACCATTTAATAGAGG + Intergenic
997003861 5:129795755-129795777 CTGCTAAGTCCATTTGTTGTAGG + Intergenic
997440480 5:133905578-133905600 CTGCATGCTCCCTTTGCTGGAGG - Intergenic
1001079537 5:168657180-168657202 CTCCCATGTCCTTTTGATGGTGG - Intergenic
1010956294 6:82094332-82094354 CTACTAGGTCCCTTTGCCAGTGG - Intergenic
1013755495 6:113456823-113456845 CTTCTAGGCCCCTTTGCTGCAGG - Intergenic
1014576874 6:123083957-123083979 CTGCAAGCTCCCATTGATGGGGG - Intergenic
1017556092 6:155570782-155570804 CTGCTAAGTCCATTTGTTGTAGG + Intergenic
1019146468 6:169978522-169978544 CTGCTAGATCCCCTTGACAGAGG + Intergenic
1029272204 7:99384044-99384066 CTTCCAGGTCCCTGTGATGCTGG + Intronic
1032713780 7:134486743-134486765 CTCCTAGGTCCTCTGGATGGAGG - Intergenic
1034858566 7:154577027-154577049 CAGCTAGGTTCCTGTGATGATGG + Intronic
1041266413 8:56069703-56069725 CTGCTTGGTCACTTTTTTGGCGG + Exonic
1042029370 8:64458943-64458965 CTGCCATGTCCCTTTGATAGTGG - Intergenic
1045726283 8:105177455-105177477 CTCATAAGTCCCTTTGATAGAGG - Intronic
1049720989 8:144115451-144115473 CTCAGAGGTGCCTTTGATGGTGG + Exonic
1059032901 9:110719726-110719748 CTGTTAGGTCCATTTGTTGTAGG - Intronic
1187589073 X:20695789-20695811 CTGTTAGGTCCATTTGTTGTAGG - Intergenic
1190267526 X:48836071-48836093 CTCCAAGGTCACTTTGAGGGAGG - Intergenic
1192268507 X:69556671-69556693 CTGCTACTGCCCTTTGAAGGGGG + Intergenic
1192545310 X:72007954-72007976 CAGCTGGGTGCCTTTGCTGGGGG + Intergenic
1194996885 X:100600793-100600815 CTGCTAGCTCCCTGTGATTTGGG - Intergenic
1195690749 X:107622646-107622668 CTGCAAGGTCCCTCTGAGTGTGG + Intergenic
1197374586 X:125666223-125666245 CTGCTAGGTCCATTTGGTCAAGG - Intergenic
1197657203 X:129129754-129129776 TTGCTAGGTACTTTTGATGAAGG - Intergenic
1201992046 Y:20037690-20037712 CTACTAGGTCCACTTGATCGAGG - Intergenic