ID: 903657749

View in Genome Browser
Species Human (GRCh38)
Location 1:24959428-24959450
Sequence TGCCTGGCGCCACGTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903657749_903657754 0 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657754 1:24959451-24959473 AGCGCCATAGTGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 58
903657749_903657751 -9 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657751 1:24959442-24959464 CGCCAGGCAAGCGCCATAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 42
903657749_903657759 29 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657759 1:24959480-24959502 GGTCAGTCTGTTCCTCTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 209
903657749_903657757 5 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657757 1:24959456-24959478 CATAGTGGGCACGGAAGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 165
903657749_903657760 30 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657760 1:24959481-24959503 GTCAGTCTGTTCCTCTCCCAGGG 0: 1
1: 0
2: 2
3: 23
4: 183
903657749_903657750 -10 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657750 1:24959441-24959463 GCGCCAGGCAAGCGCCATAGTGG 0: 1
1: 0
2: 0
3: 2
4: 51
903657749_903657755 1 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657755 1:24959452-24959474 GCGCCATAGTGGGCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 39
903657749_903657753 -4 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657749_903657758 8 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657758 1:24959459-24959481 AGTGGGCACGGAAGGGCTGGCGG 0: 1
1: 0
2: 5
3: 41
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903657749 Original CRISPR TGCCTGGCGCCACGTCTGCT AGG (reversed) Intronic
901263747 1:7893373-7893395 TGCTTGGAGCCCCGGCTGCTCGG + Intergenic
903337799 1:22636617-22636639 AGCCTGGAGCCACTCCTGCTGGG + Exonic
903657749 1:24959428-24959450 TGCCTGGCGCCACGTCTGCTAGG - Intronic
908901878 1:68964989-68965011 TGCCTGCCTCCACCTCTGCCAGG + Intergenic
919920422 1:202163737-202163759 TGCCTGGGGCCAGGACTGCTGGG + Intergenic
922344079 1:224681588-224681610 TGCCAGGCACCACGCATGCTGGG - Intronic
922925460 1:229343245-229343267 TGCCTGGGACAGCGTCTGCTGGG - Intronic
923144653 1:231189624-231189646 TGCCAGGCACCAAATCTGCTAGG - Intronic
1062952768 10:1517040-1517062 GGCCTGACGCCACGACCGCTGGG - Intronic
1067759863 10:49036760-49036782 TGCCTTGTTCCACATCTGCTGGG - Intronic
1071526894 10:86364424-86364446 TGCCTGGGGCCACCCCAGCTTGG - Intronic
1075725351 10:124608100-124608122 TCCCTAGTGCCAGGTCTGCTGGG + Intronic
1076687505 10:132204677-132204699 TGCCGGGCACCTGGTCTGCTTGG + Intronic
1078472711 11:11604550-11604572 CGCCTGGCACCAAGTCTGCATGG + Intronic
1083609485 11:63998254-63998276 TGCCTTGCACCCCCTCTGCTTGG + Exonic
1083718478 11:64592354-64592376 TGCCTGGCGCCCCATCTGGGAGG - Intronic
1084327605 11:68410833-68410855 TGCCTGTCGCCTGTTCTGCTAGG + Intronic
1084752457 11:71213198-71213220 TGCCTGGCCCCTCAGCTGCTAGG - Intronic
1085654092 11:78296652-78296674 TGCCTTGTGCCACCTCAGCTGGG + Intronic
1086061797 11:82707609-82707631 TGCCTGGCACCTGGTGTGCTGGG + Intergenic
1089486283 11:118848782-118848804 TGCCTGGAGTCACAGCTGCTTGG - Intergenic
1089538430 11:119174754-119174776 TGCATGCCCCCACGCCTGCTGGG + Exonic
1092104958 12:5914736-5914758 AGCTTGGGGCCATGTCTGCTAGG + Intronic
1096551751 12:52377864-52377886 TGCCTGGCCCCATGTCCTCTTGG - Exonic
1101244793 12:102875140-102875162 AGCCTGGCGCCTCGTCTTCAGGG + Intronic
1101860261 12:108476744-108476766 TGCCTGTCGTCTCATCTGCTAGG - Intergenic
1102258583 12:111430024-111430046 TTCCTGGGCCCACGTCTCCTGGG + Intronic
1104078825 12:125412620-125412642 GGCCTGGCCACACGGCTGCTTGG + Intronic
1104910497 12:132238005-132238027 TGCCTGGCTCCCCGTCTGCTGGG - Intronic
1105558834 13:21471739-21471761 TGCCTGGAGCCAAATCTGCTTGG + Intergenic
1106995365 13:35475101-35475123 TGCCAGTCGCCACGTTTGTTTGG + Exonic
1112459219 13:99588578-99588600 TGCCTGGCGGCCCATCTGCTTGG - Intergenic
1112484697 13:99809895-99809917 TCCCTGGGGACAAGTCTGCTTGG - Intronic
1112736824 13:102430380-102430402 AGCCTGGGGACATGTCTGCTGGG + Intergenic
1113922369 13:113920266-113920288 TGCCAGGCCCCATGTGTGCTGGG + Intergenic
1117244624 14:53871858-53871880 TGCTTGGACCCTCGTCTGCTTGG - Intergenic
1117581814 14:57158771-57158793 TGCCTGGAGCCACGGAAGCTGGG + Intergenic
1122121685 14:99557567-99557589 AGCCTGGCTTCACCTCTGCTGGG - Intronic
1124938617 15:34196579-34196601 TGCCTGCCGCCACGCCTGGCAGG - Intronic
1127526372 15:59796197-59796219 TGCCTGTCGCCCCAGCTGCTTGG - Intergenic
1129465484 15:75722180-75722202 GGCCTCGAGCCACGGCTGCTAGG + Intergenic
1129889832 15:79064614-79064636 TGCCTGCTGCCACATCAGCTAGG + Intronic
1132769972 16:1556380-1556402 GGCCTGGCGCCTCCTCTGCCTGG + Intronic
1135550047 16:23390827-23390849 TGCCTGGCGGCACCTTTGCTGGG - Intronic
1136533678 16:30886765-30886787 TGCCTGGCCACACTTCTGGTTGG - Intronic
1139280749 16:65768344-65768366 TGCTTAGCGCCAGGCCTGCTGGG - Intergenic
1139664778 16:68448039-68448061 TGCCTGGCGACGGGGCTGCTCGG - Intronic
1142419986 16:89964138-89964160 TGCAGGGCGTCACGGCTGCTGGG + Intronic
1144576632 17:16433779-16433801 TGCCAGGAGCCAGGTCTGGTGGG + Intronic
1147228104 17:38996537-38996559 TGCTTGGCGCCATGCCTGCCAGG + Intergenic
1147263495 17:39222265-39222287 TGCCAAGAGCCACCTCTGCTAGG + Intronic
1148462333 17:47845936-47845958 TGCCTGGCTCAGCTTCTGCTGGG + Exonic
1149082810 17:52678402-52678424 GGCCTGGGGTCATGTCTGCTAGG - Intergenic
1149991335 17:61385203-61385225 AGCCTGGAGCCATGTCTGCCTGG + Intronic
1151275043 17:73027941-73027963 CCCCTGGGGACACGTCTGCTTGG - Intronic
1158535828 18:58307237-58307259 AGCCTGGCCCCTCGTCTTCTTGG + Intronic
1161060191 19:2210901-2210923 TGCCTGGGGTCCCCTCTGCTGGG + Intronic
1161714239 19:5866477-5866499 TGCCTGGGGCCTCGGCTGCCTGG - Exonic
1162475914 19:10899271-10899293 TGCCTGGCGCCAGGTCAGAGAGG + Intronic
932359808 2:71094910-71094932 TGCCTGGTGCCAGGTCTGAGAGG + Intergenic
932853658 2:75213039-75213061 TTCCTGGCGTCAGTTCTGCTTGG + Intergenic
933111552 2:78408057-78408079 TGCCTGGGGGCAGGTCTGCCAGG + Intergenic
935088336 2:99869958-99869980 TGGCAGGCGTCACCTCTGCTAGG - Intronic
935579782 2:104746515-104746537 TCCCTGGCCCCGCCTCTGCTTGG + Intergenic
937370689 2:121295417-121295439 TGGCTGGTGGCACCTCTGCTTGG + Intergenic
937870734 2:126784275-126784297 TGGCTGGAGCCATGTCAGCTGGG + Intergenic
938369820 2:130762141-130762163 TGGCTGCAGCCACGGCTGCTGGG - Exonic
939466553 2:142563227-142563249 TGGCCGGTGCCACCTCTGCTTGG - Intergenic
940817365 2:158311021-158311043 TGCCTGGCCACCCGTCTTCTGGG - Intronic
942054051 2:172166137-172166159 TGCCTGTGGCCCCGGCTGCTCGG + Intergenic
948503172 2:238409450-238409472 GTGCTGGCGCCACGCCTGCTGGG - Intergenic
1174820839 20:53725252-53725274 TCCCTGGCGCCCTCTCTGCTAGG + Intergenic
1175278903 20:57789392-57789414 TCCCTTGCGCCCCGTCTGCATGG + Intergenic
1180074203 21:45454551-45454573 TGCCTGGCTCCACCTCTGATGGG + Intronic
1184283152 22:43450289-43450311 TGCCTGGCCACATGCCTGCTGGG + Intronic
1184675078 22:46037142-46037164 TGTGTGGCGCCAAGCCTGCTGGG + Intergenic
951887373 3:27537595-27537617 TGCCCGGCACCACGCCCGCTAGG + Intergenic
952857367 3:37783242-37783264 TGCCAGACTCCTCGTCTGCTTGG + Intronic
959408078 3:105986252-105986274 TGCCTGGTGCCAGGTCTGAGAGG + Intergenic
968657923 4:1786628-1786650 TGCGTGGGGCCTCGTCTGCCCGG - Intergenic
969304334 4:6317276-6317298 TGCCTGCCGCCAGGTCTTCCTGG + Intergenic
969665103 4:8552886-8552908 TGCCTGGTGCCAGGTATGCAGGG + Intergenic
973140764 4:46765679-46765701 TGCCTGGGGCCACATCGGCTGGG - Intronic
980729554 4:136809525-136809547 GGCCTGGAACCACGTCTGTTGGG + Intergenic
996822888 5:127650208-127650230 AGCCTGCAGACACGTCTGCTTGG - Intronic
998114466 5:139525627-139525649 TGCCTGGGGCCAGGTGTGGTTGG + Intergenic
1000545706 5:162598801-162598823 TGCCTGTAGTCACATCTGCTTGG - Intergenic
1002140092 5:177133095-177133117 CGCCTGCGGCCGCGTCTGCTCGG + Intronic
1005811618 6:29520332-29520354 TGCCTGACTCCACATCTGCAGGG - Intergenic
1005917903 6:30370219-30370241 TGCCTGCAGCCACGACTGATGGG - Intergenic
1006552478 6:34836178-34836200 TGCCTGGGCCCAGGACTGCTGGG - Exonic
1007138054 6:39542028-39542050 TGCCTCGTCCCACGTGTGCTAGG - Intronic
1010559798 6:77334433-77334455 TGGCTGGCGGCACCTCTGCTTGG - Intergenic
1018371255 6:163170358-163170380 TGCCTGGCCCACCGTCAGCTCGG + Intronic
1018903070 6:168060763-168060785 TGGCTGTCACCACGTGTGCTGGG + Exonic
1018947453 6:168357233-168357255 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947536 6:168357508-168357530 TGCCTGGGGCCACCCCTGCCGGG - Intergenic
1018947667 6:168357947-168357969 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947687 6:168358002-168358024 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947705 6:168358057-168358079 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947725 6:168358112-168358134 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947876 6:168358606-168358628 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947894 6:168358661-168358683 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947914 6:168358716-168358738 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1019444929 7:1066339-1066361 AGCCTGGCCCCAAATCTGCTAGG - Intronic
1019606156 7:1911242-1911264 TCCCTGGCACCACCTCTGCTCGG + Intronic
1019736446 7:2652310-2652332 AGCCAGGCGCCAGGCCTGCTGGG - Intronic
1022535596 7:31096331-31096353 TGCCTGGCCGCACTTCTGCCTGG - Intronic
1023577595 7:41645844-41645866 TGCCTGTCGCCCCAGCTGCTTGG - Intergenic
1024559126 7:50628639-50628661 TGGCTGGTCCCCCGTCTGCTGGG - Intronic
1026867304 7:73831684-73831706 TGCCTCGCTCTACGTCGGCTGGG + Exonic
1029463668 7:100711575-100711597 TGCCTGCCACCACCTCTGCTGGG - Intergenic
1034106254 7:148493123-148493145 TGCCTGGTTCCACCTCAGCTGGG + Intergenic
1034597586 7:152212896-152212918 TGCCTGCCACCACGCCTGCCTGG - Intronic
1034644998 7:152638351-152638373 TGCCTGCAGTCACGGCTGCTCGG + Intergenic
1037382304 8:18299321-18299343 TGCCTTGCTCCAGCTCTGCTTGG - Intergenic
1044614033 8:94120845-94120867 TGGCTGGCGGCACCTCTGCTTGG - Intergenic
1047282173 8:123455249-123455271 TCCCTGCCGCCATGGCTGCTTGG + Intronic
1047381926 8:124372267-124372289 TGCCCGGCGCCTCGGCTGCCTGG - Exonic
1048604145 8:135950156-135950178 TGGCTGGTGCCACATCAGCTTGG + Intergenic
1049041587 8:140116042-140116064 TGCCTGCTGCCCCCTCTGCTGGG - Intronic
1050505364 9:6342604-6342626 AGAGTGGCTCCACGTCTGCTTGG - Intergenic
1056905798 9:90646657-90646679 TGGCTGGTGCCAAGACTGCTGGG - Intergenic
1061208556 9:129177809-129177831 TGCCCGGCGCCGCGTACGCTAGG + Exonic
1061419640 9:130466314-130466336 GGCCTGGCCCCACGTGTGGTCGG - Intronic
1062074433 9:134576887-134576909 TGCCTGGCCCTAGCTCTGCTAGG + Intergenic
1186495482 X:10009678-10009700 TGCCTGGAGACATGTTTGCTTGG - Intergenic
1198398855 X:136251000-136251022 TGCCTCGCGCCGCGTCCGCGGGG + Intronic
1201714007 Y:17023548-17023570 TGCCTGAAGCCACAGCTGCTTGG - Intergenic