ID: 903657753

View in Genome Browser
Species Human (GRCh38)
Location 1:24959447-24959469
Sequence GGCAAGCGCCATAGTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903657745_903657753 11 Left 903657745 1:24959413-24959435 CCGCCATCAAAGGGACCTAGCAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657749_903657753 -4 Left 903657749 1:24959428-24959450 CCTAGCAGACGTGGCGCCAGGCA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657746_903657753 8 Left 903657746 1:24959416-24959438 CCATCAAAGGGACCTAGCAGACG 0: 1
1: 0
2: 1
3: 6
4: 39
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106
903657743_903657753 20 Left 903657743 1:24959404-24959426 CCTCAGAAGCCGCCATCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903657753 Original CRISPR GGCAAGCGCCATAGTGGGCA CGG Intronic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
901810478 1:11764470-11764492 GGCAAGAGGCTTAGTGGGCCTGG + Exonic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG + Intronic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
912861517 1:113218063-113218085 GGCTAGCACCATTGTGGGCAGGG - Intergenic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
919761706 1:201102217-201102239 GGCAGGCTCCAGACTGGGCAGGG + Intronic
920183485 1:204146850-204146872 GGCAAGTGCCCTGGTGGGCCTGG - Intronic
922176969 1:223204560-223204582 GGCAAGTGCCCATGTGGGCAAGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
922868772 1:228883384-228883406 GGCAAGTGCCATCGTGGGGCAGG - Intergenic
1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG + Intronic
1072547944 10:96455019-96455041 GGCAAGCACCATATGGGGAAAGG - Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1073841218 10:107501292-107501314 GGCAAGCAACAGAGTGGACAGGG + Intergenic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG + Intronic
1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085762323 11:79252705-79252727 GTCAAGCTCCCTAGTGGGTAGGG - Intronic
1086495455 11:87400002-87400024 GGCAAACCCAATAGTGGCCATGG - Intergenic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104849015 12:131862290-131862312 GGCCAGCGTGACAGTGGGCAGGG + Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG + Intergenic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1131022559 15:89111630-89111652 GGAAAGCTCCTTAGAGGGCAGGG - Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1133775575 16:8892470-8892492 GGCAGGCGCTATCGTGGGCGTGG - Exonic
1134093814 16:11405710-11405732 AGGAAGCCCCATAATGGGCAGGG - Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG + Intergenic
1142859658 17:2753636-2753658 GGTAAGGGCCAAAGTGTGCAAGG + Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1167773405 19:51538044-51538066 GGCACTCGTCATTGTGGGCAGGG + Intergenic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
929543794 2:42842557-42842579 GACAAACGCCATAGTGGGCGAGG - Intergenic
931620747 2:64207067-64207089 GGCATACATCATAGTGGGCATGG - Intergenic
944131046 2:196347764-196347786 GACAAGCACCATGGTTGGCAAGG - Intronic
944688420 2:202137918-202137940 GGCAAACGCCAAAGTGGGGATGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
1168860329 20:1041715-1041737 GGGAAGAGCCATAGGAGGCAGGG - Intergenic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173193758 20:40896772-40896794 GGCACACACCATAGTGTGCAGGG - Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1184919165 22:47593536-47593558 GGCAAGAGCCAGAGAGGGGAGGG - Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
953421557 3:42757249-42757271 GGCAAAGGCCCTGGTGGGCAGGG + Intronic
955195486 3:56801786-56801808 GGCAGCCGCCATGGTGGCCAAGG - Intronic
955326583 3:58013312-58013334 GGCCAGCGCCAGAGCAGGCAGGG + Intronic
960260239 3:115559462-115559484 GGCAAGCTCCATGGTATGCAAGG - Intergenic
961564401 3:127753431-127753453 GGCAAGGGCCATTTTGTGCAGGG - Intronic
962169451 3:133085350-133085372 AATAAGCACCATAGTGGGCAAGG - Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
985554963 5:554128-554150 GGCAAGCGGCATAGGGGCCAGGG - Intergenic
985972060 5:3386123-3386145 GGCCAGCTCCAGAGTGCGCAGGG + Intergenic
997405126 5:133639648-133639670 TGGAAGCCCCATGGTGGGCAGGG + Intergenic
999440520 5:151597247-151597269 GCCAAGCCCCTGAGTGGGCAAGG - Intergenic
999776462 5:154816202-154816224 GGCAGGCACCAGACTGGGCAGGG - Exonic
1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG + Intronic
1003346266 6:5270738-5270760 GGTAAGCGCCATAGTCGTCAGGG - Intronic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG + Intronic
1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG + Intergenic
1021332267 7:19353383-19353405 GGCATGTGGCATAGAGGGCATGG - Intergenic
1024518788 7:50284591-50284613 GGCCAGCAGCATAGTGGGAATGG - Intergenic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1025850294 7:65238941-65238963 GGCAACCCCCATCCTGGGCAAGG - Intergenic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1033056338 7:138058409-138058431 GGCAGGGGCCGTAGTGGGTAGGG - Intronic
1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG + Intergenic
1035082306 7:156226943-156226965 GGCAAGTGCCAGAGGGGTCAGGG + Intergenic
1035714137 8:1740928-1740950 GGGAAGCCCCATGGTGGGCTGGG - Intergenic
1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG + Intergenic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1040902782 8:52433946-52433968 GTAAAGCGCCATGGTGGGCAGGG - Intronic
1041693826 8:60714938-60714960 CGCAGGCGCCATAGTGGGGAGGG + Intronic
1042089792 8:65146118-65146140 GGCAAGAGACATAATGGGGAGGG + Intergenic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1046521421 8:115330880-115330902 GGCCAGCGCAAGGGTGGGCATGG - Intergenic
1049470831 8:142774364-142774386 GGCCAGCGCTATTCTGGGCAGGG - Intronic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1062151675 9:135022525-135022547 GGCAGGCGCCACAGTGGCCCAGG + Intergenic
1062665068 9:137666159-137666181 GGCAAGCGGCATGGAGGACAAGG - Intronic
1186349315 X:8727328-8727350 TGCAGGGACCATAGTGGGCAGGG - Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG + Intergenic
1197885028 X:131209463-131209485 TGCAAGCTCCATGGGGGGCAAGG - Intergenic
1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG + Intronic
1202080155 Y:21075832-21075854 CACAATCACCATAGTGGGCATGG - Intergenic