ID: 903663092

View in Genome Browser
Species Human (GRCh38)
Location 1:24990639-24990661
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1060
Summary {0: 4, 1: 31, 2: 125, 3: 281, 4: 619}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663087_903663092 -7 Left 903663087 1:24990623-24990645 CCAGGAATAGGGCCTGCTTCAGG No data
Right 903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG 0: 4
1: 31
2: 125
3: 281
4: 619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900033331 1:386966-386988 CTTCAGGCATGGCTTGATCCAGG - Intergenic
900054169 1:616855-616877 CTTCAGGCATGGCTTGATCCAGG - Intergenic
900081622 1:862791-862813 CATCAGGCATGGCTGGATCCAGG + Intergenic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900639834 1:3683379-3683401 ATTCAGGCATGGCTGGATCCAGG + Intronic
900639841 1:3683413-3683435 CTTCAGGCATGGCTAGATCCAGG + Intronic
900710826 1:4112605-4112627 CTTCAGGAACGGCTTGATCCAGG - Intergenic
900857738 1:5199528-5199550 CTTCAGGCACAGTGGTATCCAGG - Intergenic
901474111 1:9477304-9477326 CTTCAGGCAGAGGTGGATCCAGG - Intergenic
901508683 1:9702988-9703010 CTTCAGGCATGGCTGGATCCAGG + Intronic
901715256 1:11148550-11148572 CTTTAGGCATAGCTGGATGCAGG + Intronic
901760385 1:11467364-11467386 CTTCAGGTATAGCTTGATCCAGG + Intergenic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
901826442 1:11864809-11864831 CATCAGGCATTGCTGGATCCAGG - Intergenic
901834350 1:11914251-11914273 CTTCAGGAACGGTTTGATCCAGG - Intergenic
901840113 1:11949013-11949035 CTTCAGGCATGGCTGGATCCAGG + Intronic
901866260 1:12109025-12109047 CTTCAGGCATGGCTGGATCCAGG + Intronic
902148577 1:14423996-14424018 CTTAAGGCACATATGTATCCAGG - Intergenic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902257099 1:15196976-15196998 CTTCAGACACAGCGGGATCCAGG + Intronic
902270264 1:15299289-15299311 CTTCAGGCATGACTGGATCCAGG + Intronic
902438856 1:16416132-16416154 CTTGTGGCACAGATGGATGAAGG - Intronic
902669888 1:17965881-17965903 CTTCAGGCACAGCCTGATCCAGG - Intergenic
902905571 1:19554269-19554291 CTTCAGGTATGGCTGGATCCAGG - Intergenic
903026965 1:20436210-20436232 TTTCAGGCATGGCTGGATCCAGG - Intergenic
903040619 1:20527216-20527238 CCTCAAGCACACATGGACCCAGG + Intergenic
903060967 1:20668360-20668382 TTTCAGGCACGGCTGGATCTAGG - Intronic
903298059 1:22358398-22358420 TTTCAGGCATGGCTGGATCCAGG - Intergenic
903345715 1:22682947-22682969 CTCCAGGCATGGCTGGATCCAGG - Intergenic
903475600 1:23617182-23617204 CTTCGGGCATTGCTGGATCCAGG - Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
904372570 1:30059146-30059168 CCTCAGGCACAGCTGGACTCAGG + Intergenic
904416783 1:30366922-30366944 CTTCAGGCATGGCTGGATCCGGG + Intergenic
904432131 1:30471108-30471130 CTTCAGGCATGACTGGATCCAGG + Intergenic
904480367 1:30789515-30789537 CTTCAGGTGCGGTTGGATCCAGG + Intergenic
904588237 1:31592125-31592147 GTCCAGGCACAGCTGGAACCAGG + Intergenic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
904907774 1:33910825-33910847 CTTCAGGCAGTGCTGGATCAAGG - Intronic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
906638807 1:47428690-47428712 TTTCAGGCAGAGCTGGATCCAGG + Intergenic
907046093 1:51301056-51301078 CTTCAGGTAGGGCTGGATCCAGG - Intronic
907875050 1:58477762-58477784 CTTCAGGCACAGTTTAATCCAGG - Intronic
908038062 1:60077250-60077272 TTTCAGGCATAGCTGGATCCAGG - Intergenic
908120073 1:60978080-60978102 CTTCAGACACAGCTTGACCCAGG + Intronic
908298325 1:62735764-62735786 CTCCAGGGACATCTGGATCCAGG + Intergenic
908736438 1:67282050-67282072 CTTCAAGCACACCTTGATCCAGG + Intergenic
908790144 1:67773014-67773036 CTTCAGGCACAGCTGTATTCAGG - Intronic
909568371 1:77080667-77080689 CTTCAGGCTCAGCTTGATCCAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
910781500 1:90940598-90940620 CCTCAGGTACAGATGGATTTAGG - Exonic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
912235138 1:107843036-107843058 CTTCAGGAACAAGTGGAACCAGG - Intronic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
914439790 1:147694685-147694707 CTTCAGGTGCTGCTGGATCCAGG + Intergenic
915255329 1:154624120-154624142 CTTCAGGCATGGCTGGATCCTGG - Intronic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920106722 1:203558573-203558595 CTCCAGGCACAGCTAGATCCAGG + Intergenic
920904603 1:210150262-210150284 CTTCAGGCACTCATTGATCCAGG - Intronic
921188668 1:212691152-212691174 CTTCAGCCTCAGAGGCATCCTGG - Intronic
922255691 1:223891120-223891142 CTTCAGGCATGGCTTGATCCAGG - Intergenic
923096536 1:230779436-230779458 CTTCAGGCACAGTTCTATCAGGG + Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924336887 1:242993985-242994007 CTTCAGGCATGGCTTGATCCAGG - Intergenic
1062801321 10:382850-382872 ATTCAGGCACAAGTGGATCTAGG + Intronic
1063121008 10:3105777-3105799 CTTCAGGCACTGTTGGCTCCAGG + Intronic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065187663 10:23184564-23184586 CTTCAAGCACAGATTAACCCAGG + Intergenic
1065244206 10:23741301-23741323 CTTGAGGCATGGCTGGATCCAGG - Intronic
1066702663 10:38146557-38146579 GTTCAGGCCCAGATTGTTCCAGG - Intergenic
1066757340 10:38723883-38723905 CTTCAGGCATAGTTGGATACAGG - Intergenic
1066989007 10:42494798-42494820 GTTCAGGCCCAGATTGTTCCAGG + Intergenic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067328460 10:45292303-45292325 CTTCAGGCTCTGACAGATCCAGG - Intergenic
1067346486 10:45442136-45442158 CCTCAGCCAGAAATGGATCCAGG + Intronic
1067910297 10:50339618-50339640 TTTCAGGCACCGATAGACCCTGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1071957400 10:90774136-90774158 CTTCAGGCCCATCTTGATCCAGG + Intronic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1072534700 10:96353314-96353336 CTTCCCGCAGAGAGGGATCCAGG + Intronic
1073474696 10:103745258-103745280 TTTCAGGCATAGCTGGATCTAGG - Intronic
1074200156 10:111227444-111227466 CTTCAGGCATGGATGGATCCAGG + Intergenic
1074368393 10:112878610-112878632 CTTCAGGTACAGCTGAATCCAGG - Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1074401102 10:113141648-113141670 CCTCAGGCAGACATGGATGCAGG + Intronic
1074980831 10:118619002-118619024 CTTCAGGAAGAGCAGGATCCAGG - Intergenic
1075021555 10:118956251-118956273 CTTCAGGCAGAGTTGGTCCCAGG - Intergenic
1075028103 10:119001863-119001885 CTTCAGGCCTGGCTGGATCCAGG + Intergenic
1075079377 10:119372610-119372632 CTTCAGGTATGGCTGGATCCAGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075311354 10:121416520-121416542 CTTCAGATACAGCTTGATCCAGG - Intergenic
1075514819 10:123100383-123100405 TCTCAGCCACAGGTGGATCCAGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1075687384 10:124373746-124373768 CTTCAAGCCCAGCTGGACCCAGG - Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1076703041 10:132284164-132284186 CCTCAGGCACGGGTGGATGCGGG - Intronic
1076712436 10:132345754-132345776 CGTCAGGCACAGCCGGAGCCAGG + Intronic
1076882306 10:133245511-133245533 ATGCAGGCACGGCTGGATCCAGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077894432 11:6443180-6443202 ATTCTGGGATAGATGGATCCGGG - Intergenic
1077898590 11:6473112-6473134 CTGCAGGGACAGATGGTTGCAGG - Intronic
1078423434 11:11230586-11230608 TTTCAGGTACAGCTGGATTCAGG - Intergenic
1079399954 11:20098831-20098853 CCTCAAGCACAGCTGGATCCAGG + Intronic
1079490319 11:20981882-20981904 CTTCAGGCAAAGCTGGATTCAGG + Intronic
1080415907 11:32069995-32070017 TTTCAGGTACAGCTTGATCCAGG + Intronic
1080768378 11:35317597-35317619 CTCCAGGCACAGTTGGAATCTGG + Intronic
1081687050 11:45050123-45050145 CTTCAGGTGCAGCTGGATCCAGG - Intergenic
1081703448 11:45166161-45166183 CTTCAGGTACAGTTGGATCCAGG + Intronic
1082191070 11:49245771-49245793 CTTCAGGCATGGACAGATCCAGG - Intergenic
1083841509 11:65307485-65307507 CTTCAGGCATGACTGGATCCAGG + Intergenic
1084404610 11:68963993-68964015 CCTCAGGCATGGCTGGATCCTGG - Intergenic
1084404617 11:68964026-68964048 CCTCAGGCATGGCTGGATCCTGG - Intergenic
1084404628 11:68964092-68964114 CCTCAGGCATGGCTGGATCCTGG - Intergenic
1084404635 11:68964125-68964147 CATCAGACATAGCTGGATCCTGG - Intergenic
1084405054 11:68967086-68967108 CTTCAGGCATGGGTCGATCCAGG - Intergenic
1084409484 11:68998150-68998172 CTTCAAGAACAGCTGGATCCAGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084494515 11:69496251-69496273 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1084581093 11:70023997-70024019 CTTCAGACATAGCTGAATCCGGG + Intergenic
1084607893 11:70183187-70183209 CTTCAGGCATGGCTGGATCCAGG + Intronic
1084644904 11:70450853-70450875 CTTCAGGTAGGGTTGGATCCAGG + Intergenic
1084749324 11:71193784-71193806 CTGCAGGCACAGATTGTTCCAGG + Intronic
1085033559 11:73287065-73287087 CCTCAGGCACAGCTGAAACCAGG + Intronic
1085174763 11:74476097-74476119 CTTCAGGCACAGATTGATCCAGG - Intergenic
1085971213 11:81593123-81593145 CTTTAGGCATGGATGGATCCAGG + Intergenic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1088546048 11:110959978-110960000 CTTCTGGAACAGATGGAAGCTGG - Intergenic
1088743786 11:112787552-112787574 CTTCAGGCACAGTTTGATACAGG + Intergenic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1090652536 11:128820092-128820114 CTTCAGATACAAATAGATCCTGG - Intergenic
1091754090 12:3040603-3040625 GTTCAGGCACAGTTTGTTCCTGG - Exonic
1091953345 12:4614175-4614197 TTTCAGGCGCAGCAGGATCCAGG + Exonic
1092929643 12:13303764-13303786 TTTCAGGCACAGCTGGATCTAGG + Intergenic
1093142411 12:15524567-15524589 CCTCAGGTACAGATGGGTCTGGG + Intronic
1093878730 12:24379694-24379716 CCTCAGGAACAGTTGGAACCCGG - Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1095899590 12:47314153-47314175 CTTCAGGCTGGGAGGGATCCTGG + Intergenic
1096156194 12:49342633-49342655 CGGCAGGTACAGATGGAACCAGG + Intergenic
1096204409 12:49708556-49708578 CTTCAGGCATGGTTAGATCCAGG - Intronic
1097576179 12:61395195-61395217 CGTCAGGCTCAGATGTTTCCAGG - Intergenic
1098368562 12:69733383-69733405 CTTCAGTCACAGGTTGATCCAGG + Intergenic
1098566182 12:71939043-71939065 CTTCGGGCACTGCTGAATCCAGG - Exonic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100176100 12:92032788-92032810 ATTCAGGCACATATGGACCTGGG + Intronic
1100479740 12:94966400-94966422 CTTCAGGCACATGTAGAACCAGG + Intronic
1100786444 12:98083444-98083466 CTTCAGGTAAGGCTGGATCCAGG - Intergenic
1101050983 12:100863946-100863968 CTTCAGGCACGGTTTGATCCAGG + Intronic
1101209228 12:102519688-102519710 CTTCAGGCAAGGCTGAATCCAGG + Intergenic
1101376904 12:104179007-104179029 CTTCAGGCACAGCTTGATCTAGG - Intergenic
1101377654 12:104184675-104184697 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1101403716 12:104410309-104410331 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101579192 12:106026647-106026669 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1101583118 12:106061488-106061510 TCTCAGGCACAGTTGGATCCAGG - Intergenic
1101730459 12:107422813-107422835 TTTCAGGCATAGTTGGTTCCAGG + Intronic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1101815449 12:108142709-108142731 CTTCAGGCTTGGCTGGATCCAGG + Intronic
1101860755 12:108480586-108480608 CTTCAGGCATGGCTGAATCCAGG - Intergenic
1101921945 12:108940379-108940401 CTTCAGGCATGGCTGGCTCCAGG - Intronic
1101963913 12:109269083-109269105 CTTCAGGCATGGCTTGATCCAGG - Intergenic
1102018820 12:109667000-109667022 CTTCAGGCACAGTGCGATTCAGG - Intergenic
1102137943 12:110590863-110590885 CCTCAGGCAAAGCTGGATTCAGG - Intergenic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102194033 12:111011736-111011758 TTTCAGGCATGGCTGGATCCAGG + Intergenic
1102402791 12:112644963-112644985 CTTCAGGTACAGCTGCATCCAGG - Intronic
1102417657 12:112778605-112778627 CTTCAGGCATGGCTGGATTCAGG + Intronic
1102464607 12:113121140-113121162 CTTCAGGCATGGCTGGGTCCAGG - Intronic
1102513077 12:113428717-113428739 TTTCAGGCACAGGGGGATCCAGG + Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102558499 12:113745565-113745587 CTTCAGGTGCAGCTGGACCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1102722563 12:115030176-115030198 CTTCAGGCATAGTTAGATCCAGG + Intergenic
1102801346 12:115737164-115737186 CTTCAGGCACCGTAGAATCCAGG - Intergenic
1102805741 12:115778683-115778705 ATTCAGGCATGGCTGGATCCAGG + Intergenic
1102864138 12:116360821-116360843 TTTCAGGTCCAGCTGGATCCAGG - Intergenic
1102888321 12:116538315-116538337 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1102891550 12:116562263-116562285 TTTCAGGCACAGGTGGATCCAGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103139901 12:118539517-118539539 CTTCAGGTATAGCTGGATGCAGG + Intergenic
1103144186 12:118580072-118580094 TTTCAGGCTCAACTGGATCCAGG + Intergenic
1103197157 12:119054693-119054715 CTTCAGTTCCAGATAGATCCAGG + Intronic
1103208087 12:119145850-119145872 CTTCAGGTACAGCTGGATTCAGG + Intronic
1103227812 12:119303266-119303288 CTTCAGGCACAGCTCAATTCAGG + Intergenic
1103267573 12:119643890-119643912 CTTCAGAGGCAGCTGGATCCTGG + Intergenic
1103275649 12:119709546-119709568 TTTCAGGCATGGCTGGATCCGGG - Intronic
1103405796 12:120674428-120674450 CTACAGGCACAGCAGGATCAGGG - Intergenic
1103486436 12:121286040-121286062 CTTCAGGCATGGCTGAATCCAGG - Intronic
1103505564 12:121440659-121440681 CTTCAGGCACAGAGGGGATCTGG - Intronic
1103548469 12:121718839-121718861 CTTCAGGCAAGGCTGGATCCAGG + Intronic
1103551870 12:121743863-121743885 CTTCAGGCATCACTGGATCCAGG + Intronic
1103794704 12:123495295-123495317 CTTCAGGTACAGCTGGCTCCAGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103945589 12:124524584-124524606 GTTCAGGCACGGCTGGATCTAGG - Intronic
1103957852 12:124588435-124588457 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103981609 12:124740408-124740430 CTTCAGGTACAGCTTGATCCGGG - Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1103993360 12:124813974-124813996 ATTCAGGTACAGCTTGATCCAGG - Intronic
1104044228 12:125150438-125150460 CTTCAGGCACAGCAGGATATAGG + Intergenic
1104055866 12:125229668-125229690 CTTCAGGCATAGCTGAATCCAGG + Intronic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104098261 12:125581375-125581397 CTTCAGGTATAGTTGGATTCAGG + Intronic
1104216632 12:126740273-126740295 CTTCAGGCTCAGATGGATTCAGG - Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104265403 12:127227689-127227711 CTGCAGGCATAGCTGTATCCAGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104391945 12:128398192-128398214 CTTCAGGCACTGCTGGATTCAGG + Intronic
1104398993 12:128460239-128460261 CTTCAGGCATGGCTGGATCAAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104523042 12:129493066-129493088 CTTCAAGTACAGCTGGATACAGG - Intronic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1104564097 12:129864668-129864690 CTTCAGGCGTAGCTTGATCCAGG - Intronic
1104571538 12:129930167-129930189 CTTCAGGCATGGCTGGATTCAGG + Intergenic
1104584106 12:130034080-130034102 CTTCAGGCATCGCTGGATCAAGG + Intergenic
1104664344 12:130636797-130636819 CTTCAGTTACAGCTTGATCCAGG - Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104743707 12:131196790-131196812 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1104743726 12:131196998-131197020 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1104785808 12:131447391-131447413 CTTCAGGTGCGGCTGGATCCAGG + Intergenic
1104790613 12:131479715-131479737 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1104790629 12:131479911-131479933 CTTCAGGCATGGCTGAATCCAGG - Intergenic
1104792731 12:131493932-131493954 CTGCAGGCTCGGCTGGATCCAGG - Intergenic
1104931922 12:132344295-132344317 CCTCGGGCACAGCTGGATCCAGG + Intergenic
1104958708 12:132478108-132478130 CTTCAGGTCTAGCTGGATCCAGG + Intergenic
1104959979 12:132484088-132484110 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104959997 12:132484150-132484172 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104960017 12:132484212-132484234 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104960036 12:132484274-132484296 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104960054 12:132484336-132484358 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104960074 12:132484398-132484420 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1104960092 12:132484460-132484482 CTTCAGGCAGGGCTGGATTCAGG - Intergenic
1105265194 13:18809041-18809063 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1105352253 13:19626526-19626548 CTTAAGGCACAGATCGCTCATGG - Intergenic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1107161170 13:37229882-37229904 CTTCAGGAACAGTTTGATCAAGG + Intergenic
1107884027 13:44859229-44859251 CTTCAGGCAGGGCTGGATCTAGG + Intergenic
1107903355 13:45040121-45040143 CTTTAGGCACAACTGGATCTGGG + Intergenic
1108588778 13:51894223-51894245 CTGCAGGCACAACTGGATTCAGG + Intergenic
1109349669 13:61161994-61162016 CTACAGGCACAGAAGGTTCCTGG + Intergenic
1109558180 13:64009035-64009057 CTTCAAGCACAGTTGGTTCCAGG - Intergenic
1109731112 13:66415347-66415369 TTTCAGGAACAGATGGATTTTGG - Intronic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1110865504 13:80390321-80390343 CTTCAGGCACTTCTGAATCCAGG - Intergenic
1111901171 13:94201378-94201400 TTTCAGGCACATACGGTTCCAGG - Intronic
1112003069 13:95229744-95229766 ATTCAGGCTCAGATCTATCCTGG + Intronic
1112109977 13:96285792-96285814 CTTCAAGCATGGATAGATCCAGG + Intronic
1113105969 13:106771882-106771904 ATTCAGGGTCAGATGGACCCAGG + Intergenic
1113274620 13:108714956-108714978 GTGCAGGCAAAGATGGAACCTGG - Intronic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1116712424 14:48385009-48385031 CTTCAGGCATGGCTGGCTCCAGG + Intergenic
1116721026 14:48495552-48495574 CTTCAGGCAAAGATGAACACAGG - Intergenic
1117044984 14:51804284-51804306 CTCCAGGTACAGTTTGATCCAGG - Intergenic
1117124673 14:52609689-52609711 TTTCTGGCCCAGATGGATCTGGG + Intronic
1117215382 14:53546320-53546342 CTTCGGGCACAGCTAGATCCAGG + Intergenic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1117508876 14:56428903-56428925 CTTCAGGAACAGCTACATCCAGG + Intergenic
1117573615 14:57074617-57074639 TTTCAGGCACAGCTAAATCCAGG + Intergenic
1118325677 14:64778883-64778905 CATCAGGCACAGGTGAATGCAGG - Intronic
1118702422 14:68446799-68446821 CCTGAGGCACAGTTGGATCCAGG - Intronic
1119108566 14:71948063-71948085 ATTCAGGCTTAGCTGGATCCAGG + Intronic
1119140448 14:72262817-72262839 TGTCAGCCACAGCTGGATCCAGG + Intronic
1119200708 14:72749943-72749965 CTTCAGGCATAGCTACATCCAGG - Intronic
1119216373 14:72872138-72872160 TTTCAGCCACAGATGGCCCCTGG + Intronic
1119507694 14:75187104-75187126 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119647653 14:76359941-76359963 CTTCAGGTATGGTTGGATCCAGG + Intronic
1119672702 14:76531518-76531540 CTTCAGGCACAGAATGATCAAGG - Intergenic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1119723949 14:76910551-76910573 CTTCAGGCACAGTTTGATCTAGG - Intergenic
1119865194 14:77967305-77967327 CTTCAGGCATAGCAGGATCCAGG - Intergenic
1120073191 14:80126032-80126054 CTTCAGGCATATCTGGATCTGGG + Intergenic
1120631325 14:86895018-86895040 CTTAAGGCACAGACTCATCCTGG + Intergenic
1120839942 14:89076801-89076823 CTTCAGGTATAACTGGATCCAGG + Intergenic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1121799012 14:96757920-96757942 TTTCAGGCATTGCTGGATCCAGG + Intergenic
1122048091 14:99037615-99037637 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1122061922 14:99141621-99141643 CTTCAGGTACGGCTGGATCCAGG - Intergenic
1122416855 14:101554128-101554150 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1122652578 14:103233511-103233533 CTTCAGGTAGGGCTGGATCCAGG + Intergenic
1122903075 14:104789909-104789931 CTTCAGGGACAGAAGGGACCGGG - Intronic
1123066005 14:105619619-105619641 CATCAGGCACAGGTGAAACCTGG - Intergenic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1123758432 15:23414917-23414939 CTTCAGGAACGGCTGGATCAAGG + Intergenic
1124348382 15:28937486-28937508 CTTCAGGAACCGAGGGAACCTGG - Intronic
1124439992 15:29678686-29678708 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1124477507 15:30047549-30047571 CTTCAGACAGAGCTGGATACAGG + Intergenic
1127429875 15:58894490-58894512 CTTCAAGCACAGAGGTGTCCAGG - Exonic
1127670851 15:61193515-61193537 CTTCAGGAAGGGCTGGATCCAGG - Intronic
1128392607 15:67192695-67192717 CTTCAGGCACAGCCTGATTCTGG + Exonic
1128520851 15:68373895-68373917 CTGCAGGTACAGTTTGATCCAGG - Intronic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129373543 15:75113137-75113159 CTTCTGGCTCAGATGGAGGCAGG - Intronic
1129800785 15:78412549-78412571 CTTCAGGCAGTAGTGGATCCAGG + Intergenic
1130030964 15:80313215-80313237 CCTCAGGCAGAGCTGTATCCAGG - Intergenic
1130550430 15:84887100-84887122 TTTCAGGTATAGTTGGATCCAGG + Intronic
1130606071 15:85318187-85318209 ATTCAGGTACAGCTGGATCCAGG - Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1130932556 15:88440016-88440038 CTTCAGGCATGGCTGGATACAGG + Intergenic
1131376202 15:91925833-91925855 CTTCAAGCACGGCTGGATCTAGG - Intronic
1131537871 15:93252656-93252678 GTTCAGGCACAGCTGGATCTAGG - Intergenic
1132104850 15:99055938-99055960 CTTCAGGCATAGCTTGATCCAGG - Intergenic
1132104893 15:99056338-99056360 CTTCGGAGCCAGATGGATCCTGG + Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1132657491 16:1047353-1047375 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1132704018 16:1234007-1234029 CTACAGTAACAGAAGGATCCGGG + Intergenic
1132707503 16:1252413-1252435 CTACAGTAACAGAAGGATCCGGG - Intergenic
1132708296 16:1255747-1255769 CTTCAGGCATAGCTGCACCCAGG - Intergenic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133470829 16:6073906-6073928 CTTAAGGCACAGCATGATCCAGG + Intronic
1133532919 16:6672621-6672643 CTTCAGGTACACATGGATCCAGG + Intronic
1133566698 16:7002233-7002255 CTTCATGCACCGCTGTATCCAGG - Intronic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1133936132 16:10271015-10271037 CTTCAGGCAAGGCTGGATCTCGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134040096 16:11061811-11061833 CTTCAGGCATGGCTGGATCCGGG + Intronic
1134067501 16:11238502-11238524 CTTCAGGCATGGCTGGATGCAGG + Intergenic
1134124076 16:11604473-11604495 CTTCAGGCATGGCTGGATCCAGG + Intronic
1134127059 16:11623327-11623349 CTTCAGGCATGGCTGAATCCAGG + Intronic
1134201627 16:12204193-12204215 CGCCAGGCACAGCTGGATTCAGG - Intronic
1134396803 16:13872631-13872653 ATTCAGGAACAGCTGGATCCAGG - Intergenic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1134457908 16:14407964-14407986 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1134862434 16:17572498-17572520 CTTAAGTCACAGAAGCATCCTGG - Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135052083 16:19201352-19201374 CTTCAGGCACAGCTAAATTCAGG + Intronic
1135099458 16:19593576-19593598 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1135120258 16:19760346-19760368 CTTCAGTCATAGCTGGACCCAGG + Intronic
1135353538 16:21750473-21750495 GTTCAGATACAGCTGGATCCAGG + Intronic
1135392240 16:22103672-22103694 CCCCAGCCACAGCTGGATCCAGG + Intronic
1135452026 16:22566600-22566622 GTTCAGATACAGCTGGATCCAGG + Intergenic
1135479228 16:22807824-22807846 CTTTAGGCAAAACTGGATCCAGG + Intergenic
1135502093 16:23005095-23005117 CTTCAGGTATAGGTCGATCCAGG - Intergenic
1135527380 16:23224312-23224334 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1135542817 16:23345442-23345464 CTTCAGGCATGGCTGGATCCAGG + Intronic
1135543926 16:23353344-23353366 ATTCAGGCAAGGCTGGATCCAGG + Intronic
1135768570 16:25198933-25198955 GTTCAGGCACAACTGGACCCAGG + Intergenic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1135885800 16:26306321-26306343 ATTCAGGTACAGCTTGATCCAGG + Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1136014228 16:27384803-27384825 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136023209 16:27453215-27453237 TTTCAGGCATGGCTGGATCCGGG - Intergenic
1136041599 16:27583818-27583840 CATCAGGCATGGATGGATCTAGG + Intronic
1136046202 16:27617229-27617251 CTTTAGGCATAGGTGAATCCAGG + Intronic
1136050406 16:27646184-27646206 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136089363 16:27907298-27907320 AGTCAGGCACAGCTGGATCCAGG - Intronic
1136092366 16:27929605-27929627 CTTCAGGCATGGCTGGATCCAGG - Intronic
1136105932 16:28030550-28030572 CTTCAGTCTCAGCTGGATCCAGG - Intronic
1136106593 16:28034461-28034483 CTTCAGTCTCAGCTGGATCCAGG + Intronic
1136132487 16:28232458-28232480 CTTCAGGCATAGCCTGATCCAGG + Intergenic
1136140180 16:28283349-28283371 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136251413 16:29008049-29008071 CTTCAGGAACAAGTGGATCCAGG - Intergenic
1136720182 16:32313842-32313864 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136725235 16:32352236-32352258 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136838558 16:33520118-33520140 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136843562 16:33558292-33558314 CTTCAGGCATAGCTGGATACAGG + Intergenic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137520478 16:49191015-49191037 CTTCAGATACAAATGGATTCAGG + Intergenic
1137540397 16:49357737-49357759 ATTCAGGCATGGCTGGATCCAGG + Intergenic
1137595010 16:49717610-49717632 CTTCAGGTGCAGCTGAATCCAGG - Intronic
1137667535 16:50260415-50260437 ATTCAGGCATGGCTGGATCCAGG + Intronic
1137715029 16:50593334-50593356 CTTCAGGCACCATTTGATCCAGG + Intronic
1137750905 16:50860348-50860370 CTTCAGGCATGGCTGGATTCAGG - Intergenic
1138071659 16:53998586-53998608 CTTCAGGCATAGCTTGATCCAGG + Intronic
1138246132 16:55468455-55468477 TTTCAGGTATAGCTGGATCCAGG + Intronic
1138338433 16:56270827-56270849 CTTCAGGCATGGTTGGACCCAGG + Intronic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138381450 16:56605659-56605681 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1138622965 16:58226388-58226410 CTTCAGGCATGGCTGAATCCAGG - Intergenic
1139466647 16:67157575-67157597 CTTCAGGGACGGCTGGATCCAGG - Intronic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140336437 16:74109323-74109345 CTTCAGGCACATTTGGTTCCAGG - Intergenic
1140518413 16:75561414-75561436 CTTCTGGAATAGATGGATCTAGG + Intergenic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1140863955 16:79043515-79043537 GTTCAGGCATAGCTGGATCCAGG + Intronic
1141157609 16:81608302-81608324 CTTCAGGCATTGCTGGATCCGGG + Intronic
1141251287 16:82361278-82361300 CTTCAGGCATAGTTAGATCCAGG - Intergenic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141461921 16:84182861-84182883 GTTCAGGCACAGCTGCATCCAGG - Intronic
1141536131 16:84681410-84681432 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1141536501 16:84684775-84684797 CTTCAGGCATAGCTGTATCCAGG + Intergenic
1141907035 16:87033647-87033669 CTTCTGGCACAGATGGCTGGGGG - Intergenic
1141946890 16:87316883-87316905 CTTCAGGCATGGATGTATCCAGG - Intronic
1141976564 16:87520148-87520170 CTTCAGGCGCAACTGGATCCAGG + Intergenic
1141988234 16:87593918-87593940 CTTCAGGTACTGCTGGATCCAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142353508 16:89590609-89590631 CCTCAGGCACTGCTGGATCCAGG + Intronic
1203001195 16_KI270728v1_random:165518-165540 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203006249 16_KI270728v1_random:203927-203949 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203132798 16_KI270728v1_random:1701922-1701944 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203148722 16_KI270728v1_random:1820404-1820426 CTTCAGGCATAGCTGGATACAGG + Intergenic
1203153727 16_KI270728v1_random:1858590-1858612 CTTCAGGCATAGCTGGATACAGG + Intergenic
1142514378 17:417484-417506 CTTCAGTCATGGCTGGATCCAGG + Intronic
1142860635 17:2758825-2758847 TTTCAGGCACAGCTAGATTCAGG + Intergenic
1142873498 17:2836674-2836696 CTTCAGGTCCAGCTAGATCCAGG + Intronic
1142879124 17:2870797-2870819 CCTCAGAAACAGCTGGATCCAGG + Intronic
1143285407 17:5785392-5785414 CTTCTTGCACAAATGGAACCTGG - Intronic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1143831860 17:9658774-9658796 CTTCAGGTAGGGCTGGATCCAGG + Intronic
1143962580 17:10732759-10732781 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1144049771 17:11488562-11488584 CTTCAGGCATGGTTAGATCCAGG + Intronic
1144400932 17:14900473-14900495 CTTCAGGCAAGGCTGGAACCAGG - Intergenic
1144717326 17:17443471-17443493 CTTCAGTCATAGCTGGACCCAGG + Intergenic
1144754817 17:17672973-17672995 CTTCAGGCGCAGCTGAATCCAGG + Intergenic
1144836731 17:18160348-18160370 CCTCAGGCATAGCTGGATCCAGG + Intronic
1146168056 17:30607213-30607235 TTTTAGGCACAGCTAGATCCCGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146287419 17:31583221-31583243 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1146949667 17:36897121-36897143 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1149117829 17:53119383-53119405 CTTCAGGCATAGCAGGATCAAGG + Intergenic
1149398891 17:56273888-56273910 CTTCAGGTACAGTTTGATTCAGG + Intronic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1149792156 17:59488751-59488773 CTTCAGGCACAGCTTGACTCAGG + Intergenic
1149999041 17:61420936-61420958 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151994449 17:77599896-77599918 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1152097070 17:78278534-78278556 CTTCAAGCACAGCTGGCACCTGG - Intergenic
1152132773 17:78486951-78486973 CTTCAGGCATGGCTGGATTCAGG - Intronic
1153545082 18:6196816-6196838 CTACAGGCATAGCTGAATCCAGG - Intronic
1153656085 18:7283668-7283690 GTCCAGGCACAGTTGAATCCAGG - Intergenic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1154213078 18:12396535-12396557 CCTCAGGGACAGCTGCATCCTGG + Intergenic
1154251880 18:12751594-12751616 CTTCAGACACAACTGGATCGGGG + Intergenic
1154423201 18:14252503-14252525 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1155919520 18:31589117-31589139 CTACAGTTACAGATGGATTCTGG + Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157156571 18:45273090-45273112 TTTCAAGCTCAGATGGATCGAGG + Intronic
1157300276 18:46474222-46474244 CTTCAGGCACAGATCAGCCCTGG + Intergenic
1157413590 18:47484081-47484103 CTGCAGGGACAGAGGGCTCCTGG + Intergenic
1157905728 18:51568291-51568313 CTTCAGGCATGGCTGGAGCCAGG + Intergenic
1158310941 18:56157600-56157622 CTTCAGGTACAGCAGGATCTAGG + Intergenic
1160065864 18:75573793-75573815 CTGCAGGCACAGAAAGTTCCGGG - Intergenic
1160571086 18:79818146-79818168 CAGCAGCCACACATGGATCCAGG - Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160758281 19:769755-769777 CTTCAGGCTCAGCTGGTTCCAGG + Intergenic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160922171 19:1526145-1526167 ATTCTGGCACAGGTGGACCCAGG - Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1160943209 19:1629628-1629650 CTTCAGGCAAGGCTGGATCCAGG - Intronic
1161212229 19:3073210-3073232 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1161316678 19:3620576-3620598 CTTCAGGTAAGGCTGGATCCAGG - Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161503024 19:4627921-4627943 CTTCAGGTATGGTTGGATCCAGG + Intergenic
1161504057 19:4634559-4634581 CTTCAGGCACAGTTTGATCAAGG + Intergenic
1161616379 19:5273080-5273102 CTTCAGGTTCAGCTGGATCCAGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1161655816 19:5514208-5514230 CTTCAGGCACGGTTTGATCCAGG + Intergenic
1161685152 19:5698844-5698866 CTTCAGGCCCAGCTGATTCCAGG - Intronic
1161762755 19:6186625-6186647 CTTCAGGCATGGCTGGATCTGGG + Intronic
1161773396 19:6243413-6243435 CTTCTGGGAGAGATGGAGCCAGG + Intronic
1161914709 19:7219748-7219770 TTTCAGGTACAGCTAGATCCAGG + Intronic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162522818 19:11192094-11192116 CTTCAGGCATGGCTGGATCCAGG - Intronic
1162556740 19:11391466-11391488 CTTCAGGCACAGTTGCATCCAGG - Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163018107 19:14469202-14469224 CTTCAGGCATGGCTGTATCCAGG + Intronic
1163177125 19:15572172-15572194 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163186872 19:15644994-15645016 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163191387 19:15679291-15679313 CTTCAGGCATGGCTGAATCCAGG + Intronic
1163201845 19:15775412-15775434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1163217919 19:15894546-15894568 CTTCAGGCATGGCTGGATCCAGG - Intronic
1163221993 19:15928504-15928526 CTTCAGGCATGGTTGGATCCAGG - Intronic
1163482813 19:17568137-17568159 CTTCAGGCATGGCTTGATCCAGG + Intronic
1163535682 19:17874915-17874937 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163540910 19:17909632-17909654 CTTCAGGTGCAGCTGGCTCCAGG + Intergenic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163736249 19:18982861-18982883 CTTCAGGATCAGCTGGATCAAGG - Intergenic
1163768516 19:19176963-19176985 TGTCAGGTACAGTTGGATCCAGG + Exonic
1163782968 19:19260119-19260141 ATTCAGGCACAGTGAGATCCAGG - Intronic
1163784422 19:19267453-19267475 CTTCAGGTATGGCTGGATCCAGG - Intronic
1163862669 19:19750334-19750356 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1164464355 19:28474993-28475015 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164540243 19:29116544-29116566 TTTCAGGCAAGGCTGGATCCAGG - Intergenic
1164589198 19:29496903-29496925 CTTCAGGCATGGCTTGATCCAGG - Intergenic
1164669784 19:30065885-30065907 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164839730 19:31383763-31383785 GTCCAGGCACAGCAGGATCCAGG - Intergenic
1164882844 19:31749614-31749636 CTTCAGGCATGACTGGATCCAGG - Intergenic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165038302 19:33050298-33050320 CTTCAGGCCTAGCTTGATCCAGG - Intronic
1165118343 19:33543131-33543153 CTTCAGTTACGGCTGGATCCAGG + Intergenic
1165321376 19:35087383-35087405 ATTCAGGCATAGCTGGACCCAGG + Intergenic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1165339385 19:35199809-35199831 CTTCAGACATAGTTGTATCCAGG - Intergenic
1165341546 19:35215809-35215831 CTTCAGGCACAGTTAGATCCAGG - Intergenic
1165454871 19:35904516-35904538 CTTCAGGAATGGCTGGATCCAGG + Exonic
1165713112 19:38026130-38026152 TTTCAGGCAAGGCTGGATCCAGG + Intronic
1165766664 19:38355776-38355798 CTTCAGGTATGGCTGGATCCAGG + Intronic
1165863546 19:38922062-38922084 CTTCAGGTGCGGCTGGATCCAGG - Exonic
1166090766 19:40507365-40507387 CCTCAGGCATGGCTGGATCCAGG + Intronic
1166104763 19:40591850-40591872 CTTCAGGCATGGCTGGATCCGGG + Intergenic
1166110361 19:40618826-40618848 CTCCAGGCATAACTGGATCCAGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166655852 19:44611223-44611245 CATCAGGCACAGCTGAATCTAGG + Intergenic
1166683899 19:44783723-44783745 TTTCAGGCACAGCTAGATCCAGG + Intronic
1166770593 19:45279735-45279757 CTTCAGGCACAGTTGTATCCAGG + Intronic
1167010714 19:46805600-46805622 CTTCAGGCATAGCTGGCTCCAGG - Intergenic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167292010 19:48629699-48629721 CTACAGGCACAGATGCACCCTGG + Exonic
1167525104 19:49978801-49978823 CTTCAGGCACAACGGGATTCAGG - Intronic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167540475 19:50083917-50083939 CTTCAGGCATAACTGGATCCAGG + Intergenic
1167567947 19:50268591-50268613 CTTCAGGCCTGGCTGGATCCAGG + Intronic
1167567954 19:50268634-50268656 CTTCAGGCATGGCTGGATGCAGG + Intronic
1167567960 19:50268677-50268699 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567967 19:50268720-50268742 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567974 19:50268763-50268785 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567982 19:50268806-50268828 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167629232 19:50613880-50613902 CTTCAGGCATAACTGGATCCAGG - Intergenic
1167634747 19:50648048-50648070 CTTCAGGCATTGCTGGATCCAGG + Intronic
1167664283 19:50814565-50814587 CTTCAGGCATGGGTGGATCCAGG + Intergenic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168666818 19:58210630-58210652 CTTCAGGCAAGGCTGCATCCAGG + Intronic
925904283 2:8530007-8530029 ATCCAGGCACAGTTGGATCTAGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
927149020 2:20185266-20185288 CTTCAGGCACAGCTGGAAGTGGG - Intergenic
927150143 2:20190929-20190951 CTTCAGGCACAGATGAGACTTGG - Intergenic
928013224 2:27629909-27629931 CTTCATGTACTGCTGGATCCAGG - Exonic
928326230 2:30321857-30321879 CTCCAGGGACAGAGGTATCCGGG - Intronic
928594783 2:32849503-32849525 TTTCATGCACATCTGGATCCAGG + Intergenic
929236903 2:39615238-39615260 CTTCAAGCACAGCTGGATTAAGG - Intergenic
929237174 2:39617758-39617780 GTTTAGGTACAGCTGGATCCAGG - Intergenic
929932373 2:46268881-46268903 CTCCAGGCTCAGATGTAACCTGG + Intergenic
930014918 2:46963714-46963736 CATCAGGCATAGCTGAATCCGGG + Intronic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930866417 2:56126442-56126464 CTCCAGGAATAGCTGGATCCAGG - Intergenic
930896505 2:56452609-56452631 GCTCAGGAACAAATGGATCCTGG - Intergenic
931233128 2:60390944-60390966 ATACAGGAACAGCTGGATCCAGG - Intergenic
931331602 2:61291527-61291549 GTTCAGTCACAGCTGAATCCAGG - Intronic
931992027 2:67800034-67800056 CTTAAGGCATAGATGGTGCCTGG + Intergenic
932224895 2:70031757-70031779 CTTAAGGCACAGTTAGATCCAGG + Intergenic
933227558 2:79768276-79768298 CTTCAGGCACAGAAAACTCCTGG - Intronic
934320643 2:91968324-91968346 CTTCAGGCATAGCTGGATACAGG - Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
935508416 2:103937758-103937780 CAGCAGGCACAGATAGATTCAGG + Intergenic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
936462087 2:112721638-112721660 CTTCAGACACACATGGGTCCAGG + Intronic
937032294 2:118750909-118750931 CTTCAGGCCATGCTGGATCCAGG + Intergenic
937234365 2:120421594-120421616 CCTCAGGCCCAGGCGGATCCAGG + Intergenic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938373822 2:130791197-130791219 GTACAGGCAGAGGTGGATCCAGG - Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
938948737 2:136238154-136238176 CTTCAGGTAAAGATGGATCCAGG + Intergenic
939091515 2:137785731-137785753 CTGCAGGCACAAATAAATCCTGG + Intergenic
939185622 2:138857175-138857197 CTTCAGGCACAACTGGATTCAGG - Intergenic
939565459 2:143781808-143781830 CTTCAGGCAAAGTTGGACACTGG + Intergenic
940308407 2:152250903-152250925 CTTCAGGCATGGCTGGATCAAGG - Intergenic
940450656 2:153832140-153832162 ATTCAGGCATTGATGGAACCAGG - Intergenic
942389229 2:175475161-175475183 CTGCAGGTGCAGATGGTTCCAGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
942555177 2:177165415-177165437 CTTTAGGAAAAGATGGCTCCTGG + Intergenic
944339356 2:198577929-198577951 CTTCAGGGATATATGGATTCAGG + Intergenic
944907133 2:204273400-204273422 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
945158894 2:206868109-206868131 CTTCAGGCATGGCTGGATCTTGG - Intergenic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
945287030 2:208093086-208093108 CTTCAGGCATGGCTGGATGCAGG - Intergenic
945631858 2:212288159-212288181 CCTTAAGCACAGATAGATCCAGG - Intronic
946059597 2:216930364-216930386 CTTCAGGTATAGCTGGACCCAGG + Intergenic
946209872 2:218138978-218139000 CTCCAGGCACAGATGAGTGCAGG - Intergenic
946654258 2:221928567-221928589 TTTCAGGCCCAGTTGGAACCAGG + Intergenic
946759737 2:222981624-222981646 CTTCAGGCACACATGGAAGAAGG - Intergenic
946771394 2:223092489-223092511 CTTCAGGCAAAAATAGGTCCGGG + Intronic
947531466 2:230911375-230911397 CTTCAGGAGCAGCTGGATCAGGG + Intronic
947577788 2:231290423-231290445 GTTCAGGCACAGTTTGATCAGGG + Intronic
947643383 2:231720396-231720418 CTTCAGGTACAGCAGGATTCAGG + Intergenic
947769989 2:232662873-232662895 CTTCAGGCCCAGGTGGGTCTGGG - Exonic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948558771 2:238836392-238836414 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
948991159 2:241554770-241554792 TTTCAGGCATAGCTGGATCCAGG - Intergenic
949055270 2:241924750-241924772 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1168827390 20:823028-823050 CTCCAGGCAGAGATGGACCAGGG + Intergenic
1168842756 20:920295-920317 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1168845029 20:938630-938652 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1168928721 20:1604172-1604194 CTTGTGGCACAGACAGATCCAGG + Intronic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169190732 20:3657774-3657796 CTTCAGGCACAGCTGTCTCCAGG - Intergenic
1169268490 20:4181954-4181976 CTTCAGGTACTGCTGGATCATGG - Exonic
1169675671 20:8151481-8151503 CTACAGCCACACATGGTTCCAGG - Intronic
1169860487 20:10146317-10146339 CTTCAGGTATGGCTGGATCCAGG - Intergenic
1170194784 20:13678838-13678860 CTTCAGGTTCAGTTGGATCAAGG - Intergenic
1170464729 20:16612163-16612185 CTGCAGGCACAGACAGATTCAGG - Intergenic
1170932175 20:20779038-20779060 CTTCAGGAAAAGAGGAATCCTGG - Intergenic
1170940957 20:20847820-20847842 CTCCTGACACAGATGGATGCAGG + Intergenic
1171886028 20:30652981-30653003 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1172043876 20:32065444-32065466 CCTCAGGCATAGCTGGATCCAGG + Intronic
1172627478 20:36356196-36356218 CTTCAGGCACAGTTGAATCAGGG - Intronic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1172906217 20:38371657-38371679 TTTCAGGCATAGCTGGATCCAGG + Intronic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1173460731 20:43241265-43241287 CTTCAGGCATGGCTTGATCCAGG - Intergenic
1173665339 20:44758919-44758941 CTTCAGGCAGAGCTTGATCCAGG - Intronic
1173895686 20:46549053-46549075 CTTCAGGCATTTCTGGATCCAGG - Intronic
1173915051 20:46701435-46701457 CTTCAGGCATGGCCGGATCCAGG - Intergenic
1173916804 20:46714119-46714141 CTTCAGGTGCAGTTGGATCTAGG + Intronic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174068423 20:47882864-47882886 CTTCAGGTACTGCTGCATCCGGG + Intergenic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174085219 20:48003199-48003221 CTTCAGGCATGGATGGATCCAGG + Intergenic
1174107766 20:48175004-48175026 CTTCAGGTATAGGTAGATCCAGG - Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174129397 20:48331664-48331686 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174187499 20:48716957-48716979 CTTCAGGCATAGCTGCATCCAGG - Intronic
1174190613 20:48737885-48737907 CTTCAGGCATAGCTAGATCCAGG - Intronic
1174200573 20:48803843-48803865 CCTCAGGCACAGTTGGATCCAGG - Intronic
1174206412 20:48843245-48843267 CTTCGGGCATGGCTGGATCCAGG + Intergenic
1174210938 20:48877345-48877367 CTTCAGGCATGGATAGATCTAGG + Intergenic
1174264631 20:49322559-49322581 CTTCAGGCATGACTGGATCCAGG + Intergenic
1174265536 20:49328990-49329012 ATTCAGGCATGGCTGGATCCAGG + Intergenic
1174267755 20:49344328-49344350 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1174274511 20:49393997-49394019 CTTCAGGGATGGCTGGATCCAGG - Intronic
1174300539 20:49579054-49579076 CTTCAGGCATGGCTGAATCCGGG - Intergenic
1174327251 20:49789256-49789278 CTTCAGGTACAGCTGGATTCAGG - Intergenic
1174328519 20:49798933-49798955 ATTCAGGCATGGCTGGATCCAGG - Intergenic
1174407848 20:50313624-50313646 TTTCAGGTACAGTGGGATCCAGG - Intergenic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1174413987 20:50355101-50355123 CTTCAGGCATAGCTAGATCCAGG + Intergenic
1174427179 20:50440005-50440027 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1174435415 20:50503093-50503115 CTTCAGGCACCGCCAGATCCAGG - Intergenic
1174492406 20:50909930-50909952 CTTCGGGCACAGCTGGATTGAGG - Intronic
1174502361 20:50995019-50995041 CTTCAGGAACTGCTGGATCTAGG + Intergenic
1174518219 20:51109606-51109628 CTTCAGGCATGGATGGATCCAGG - Intergenic
1174540269 20:51283867-51283889 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174582373 20:51580958-51580980 CTTCAGGCACAGCTGTATGCAGG - Intergenic
1174703561 20:52633867-52633889 CTTCAGGCATAGTGGGATCCAGG - Intergenic
1174734065 20:52947584-52947606 CTTTGGGCATAGCTGGATCCAGG - Intergenic
1174754688 20:53146008-53146030 CTTCAGGAAAGGGTGGATCCAGG + Intronic
1174882390 20:54294262-54294284 CTTCAGGCATGGTTGTATCCAGG - Intergenic
1175052009 20:56164400-56164422 CTTCAGGTATAGCTGGATGCAGG - Intergenic
1175062709 20:56258198-56258220 CTTCAGGCGTAGCTGGATCATGG - Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175134426 20:56812289-56812311 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1175206841 20:57317661-57317683 CTTCAGGGTGAGCTGGATCCAGG - Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175380241 20:58557783-58557805 CTTCAGGCATGGTTGGATCCGGG - Intergenic
1175677823 20:60961914-60961936 CTTTAGGCTCGGCTGGATCCAGG + Intergenic
1175678131 20:60964877-60964899 CTTCAGGAACACCTGGACCCAGG + Intergenic
1175721610 20:61290886-61290908 CTTCAGGCATGGCTGGATCCAGG + Intronic
1175749146 20:61483239-61483261 TTTCAGGTCCAGCTGGATCCAGG - Intronic
1175820376 20:61905928-61905950 CTTCAGGCATGGCTGGATCTAGG + Intronic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1175831342 20:61966708-61966730 CCTCAGGCACGGCTGGATCCAGG + Intronic
1175870990 20:62209397-62209419 CTTCAGGCAGGGTTGGATCCAGG + Intergenic
1175875108 20:62225819-62225841 TTTCAGGCACAGCTGCATCTGGG + Intergenic
1175876226 20:62231493-62231515 CTTCAGGCATGGTTGGATCCAGG + Intergenic
1176033021 20:63022938-63022960 CTTCAGGCACAGTGGAGTCCAGG + Intergenic
1176070358 20:63223026-63223048 TTTCAGACTCAGCTGGATCCTGG - Intergenic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176386857 21:6142386-6142408 CTGCAGGCATGGCTGGATCCAGG + Intergenic
1178317249 21:31576930-31576952 CTTCAGGTAGAGTTGGATTCAGG - Intergenic
1178429196 21:32504177-32504199 GTTCAGGCACAGTTGTAACCAGG + Intronic
1179288689 21:39999613-39999635 CTTCAGGAGCAGCTGGATGCAGG - Intergenic
1179356324 21:40663805-40663827 CTTCAGGCCCAGAAGCATCAAGG - Intronic
1179736616 21:43395866-43395888 CTGCAGGCATGGCTGGATCCAGG - Intergenic
1180037141 21:45255843-45255865 CCTCAGGCACGGCTGGATCCAGG - Intergenic
1180173384 21:46073595-46073617 CTCCAGGCCCAGATGGCTCCTGG + Intergenic
1180308892 22:11152383-11152405 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180547369 22:16514194-16514216 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181733782 22:24866532-24866554 CTTCAGGCATGGATGGATCCAGG + Intronic
1181744656 22:24947563-24947585 CTTCAGGCATAGTGGGATCCAGG + Intergenic
1181822063 22:25484125-25484147 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1181961961 22:26628649-26628671 CTTCAAGCATAGCTGGATCCAGG + Intronic
1182109470 22:27712706-27712728 CTTCAGGCATGGCTGGATCTAGG - Intergenic
1182211795 22:28683140-28683162 CTTCAGGCATAGCTGGATACAGG + Intergenic
1182215651 22:28715349-28715371 CTTCAGGCATGGCTGGATCTAGG - Intronic
1182230859 22:28836592-28836614 CTTCAAGTACAAATGGATCCAGG + Intergenic
1182323993 22:29497804-29497826 CTTCAGGAATGGCTGGATCCAGG + Intergenic
1182533231 22:30978764-30978786 CTTCAGGCACGGTTGGATCCAGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182884174 22:33759151-33759173 CTTCAGGCAGAGTTGGATCCAGG - Intronic
1183077757 22:35437510-35437532 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1183345723 22:37306667-37306689 CTTCAGGTTCAGCTAGATCCAGG + Intronic
1184092231 22:42298891-42298913 CTTGAGGCAGGGATGGCTCCTGG - Intronic
1184430680 22:44440122-44440144 CTTCAGGCACCCCTGGGTCCTGG - Intergenic
1185140754 22:49099873-49099895 GTTCAGGAACAGAGGGATGCAGG + Intergenic
1185238102 22:49726216-49726238 CTTCAGGAATGGCTGGATCCAGG + Intergenic
1185375954 22:50482652-50482674 CTCCAGGCACAGAGGGGTGCCGG + Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949264040 3:2136265-2136287 CTTCAGGTACAGCTTCATCCAGG - Intronic
949385602 3:3498844-3498866 CTTCAGGTATAGTTTGATCCAGG + Intergenic
949394979 3:3605034-3605056 GTTCAGGCACAGTTGGAGTCAGG - Intergenic
949539668 3:5022255-5022277 CTTCAGGCATAGCTGTTTCCAGG - Intergenic
949583122 3:5410977-5410999 CTTCAGGAATAGCTGGGTCCAGG - Intergenic
949639330 3:6017170-6017192 CTTCAGGCATAGCTGGCTGCAGG - Intergenic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
949922345 3:9013017-9013039 CTTCAGGTATAGCTTGATCCAGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950190970 3:10975894-10975916 CATCAGGCATGGCTGGATCCAGG + Intergenic
950192901 3:10990633-10990655 CTTCAGGTATGGCTGGATCCAGG + Intergenic
950441036 3:13010594-13010616 CTTCAGGTACAGTTGGATTCGGG - Intronic
950493299 3:13319111-13319133 CTGCAGGCACAGCAAGATCCCGG + Exonic
950531964 3:13557453-13557475 CTTCAGGCATGGCTGTATCCAGG + Intronic
950532310 3:13559294-13559316 CTTCAGGCATGGCTGGATCCAGG + Intronic
950611476 3:14129793-14129815 CCTCAGGCGTAGTTGGATCCAGG + Intronic
950698370 3:14722074-14722096 TTTCAGGCATGGCTGGATCCAGG + Intronic
950952352 3:17013741-17013763 TTTCAGGCACACTTGGGTCCTGG - Intronic
951576298 3:24117702-24117724 CTTCAGGCATGGCTGGATCTGGG - Exonic
951629780 3:24707127-24707149 CTTCAAGCATAGATAAATCCAGG + Intergenic
952269301 3:31816636-31816658 CTGCAGCCACAGATGTTTCCAGG - Intronic
952333797 3:32387733-32387755 CTTCAGGCATGGCTGGATCCAGG - Intergenic
952814369 3:37434471-37434493 CTTCAGGCACAGCTCAATCCAGG - Intronic
953361819 3:42303890-42303912 ATTCAGGCATAGATGGATTCAGG - Intergenic
953516580 3:43598543-43598565 CCTCAGGCAAAGTTGTATCCAGG - Exonic
954855712 3:53642106-53642128 CTTCAGGCTCAACTTGATCCAGG + Intronic
954948510 3:54448036-54448058 CTTCAGGTAAGGATGAATCCAGG + Intronic
955003537 3:54948969-54948991 CTTCAGGTACAGTTGGATCTGGG + Intronic
955047881 3:55376943-55376965 CTTCAGGCATGGCTGGATCCAGG + Intergenic
955198281 3:56826203-56826225 CTTCAGGCATGGCTGGATCCAGG - Intronic
955212336 3:56953858-56953880 CTTCAGGCACAGCTGTTTCCAGG - Intronic
955215518 3:56982186-56982208 CTTCAGGCATAGCTCGATCCAGG - Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955409180 3:58644856-58644878 CTTCAGGACCACCTGGATCCAGG - Intronic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955522801 3:59791472-59791494 ATTCAGGCGCGGCTGGATCCAGG - Intronic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955658084 3:61265747-61265769 CTTCAGGCAAAATTGGATTCTGG - Intergenic
955824633 3:62932608-62932630 GTTCAGTAACAGCTGGATCCAGG + Intergenic
955835926 3:63055150-63055172 TTTCAGGCACAGTTAGATCCAGG + Intergenic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
956356774 3:68402296-68402318 TTTCAAGCACAGATGGTCCCAGG + Intronic
956380954 3:68663916-68663938 CTTCAGGAATAGCTGAATCCAGG - Intergenic
956547157 3:70417570-70417592 CTTCAGACATAGGTGGATCCAGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956731762 3:72203289-72203311 CTTCAGGCATAGCTGTATCCAGG + Intergenic
956736309 3:72241172-72241194 CTTCAGGCATGGCTGGATCAAGG + Intergenic
956752632 3:72355512-72355534 CTTCATGCATGGCTGGATCCAGG - Intergenic
956779777 3:72594788-72594810 CATCAGGCATTGCTGGATCCAGG + Intergenic
956893060 3:73631563-73631585 CTTCAGGCATGGCTGCATCCAGG + Intergenic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
957005654 3:74943675-74943697 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
957028560 3:75213988-75214010 CTTCAGGGATAGCTGGATCTAGG - Intergenic
957302869 3:78415670-78415692 TTTCAGGCACAGTTGGAATCAGG - Intergenic
957696482 3:83646033-83646055 CTTCATGCAGTGAAGGATCCTGG + Intergenic
959111827 3:102132007-102132029 CCTTAGGCACTGATGGATCCTGG + Intronic
960403093 3:117227942-117227964 CTTCAGGCACAGCTCAATTCAGG + Intergenic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961444182 3:126971383-126971405 CTTCAGGCAGGGCTGAATCCGGG - Intergenic
961459316 3:127040172-127040194 CCTCAGGCATGGCTGGATCCAGG + Intergenic
961469062 3:127100180-127100202 CTTCAGGCATGGCTGGATCCAGG + Intergenic
961495381 3:127287662-127287684 CTTCAGGCAAAGCTGGTACCGGG + Intergenic
961514781 3:127425722-127425744 CTTCAGGCACCACTGGGTCCAGG - Intergenic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961535097 3:127565766-127565788 GCTCAGGCTCGGATGGATCCAGG + Intergenic
961537622 3:127579633-127579655 CTTCAGGTATGGCTGGATCCAGG - Intronic
961558069 3:127710220-127710242 CTTCAGACATGGCTGGATCCAGG - Intronic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961651060 3:128416860-128416882 CTCCAGGCATAGCTGGATCCAGG - Intergenic
961673388 3:128550431-128550453 CTTCAGGTGCAGGTGAATCCAGG - Intergenic
961737823 3:129013413-129013435 CTTCAGGCATGGCTAGATCCAGG + Intronic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962121515 3:132565380-132565402 CTTCAGGTACTGATGGAAGCTGG + Intronic
962669034 3:137686198-137686220 TTTCAAGCACAGCTAGATCCAGG + Intergenic
962704980 3:138034306-138034328 CTTCAGACACAGCTGAATCAAGG + Intergenic
962756284 3:138467750-138467772 GGTGAGGCACAGATGGCTCCAGG + Intronic
962805483 3:138924063-138924085 CTTCAGGTATAACTGGATCCAGG + Intergenic
962835839 3:139187715-139187737 CTTCATGAATGGATGGATCCAGG + Intronic
962960136 3:140303666-140303688 CTTCAGGCACAGATTTGTTCTGG - Intronic
963487747 3:145957531-145957553 ATTCAGGCTCAGATGTATCAAGG - Intergenic
963598896 3:147360362-147360384 CTTCAGGCCCAGATGGGGACTGG - Intergenic
963651190 3:147982314-147982336 CTTCAGACACACTTGGATCCAGG + Intergenic
963710678 3:148744234-148744256 TTTCAGGCACAGTTGCATCCTGG - Intergenic
964199183 3:154098796-154098818 CTTCAGGTATTGGTGGATCCAGG - Intergenic
964807145 3:160622890-160622912 CTTCAGGGACAGATGAATCCAGG - Intergenic
964989040 3:162783781-162783803 AGTCAGACAAAGATGGATCCAGG - Intergenic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
966462113 3:180188188-180188210 TTTCAGGCATAGCTGAATCCTGG + Intergenic
967280738 3:187821243-187821265 CTACAGGTAGAAATGGATCCTGG + Intergenic
967716268 3:192765516-192765538 CTTCAGGAACAGCTGGAATCAGG + Intronic
968124430 3:196148070-196148092 ATTCAGGCATGGCTGGATCCAGG + Intergenic
968760630 4:2441450-2441472 CTGCAGGCCGAGATTGATCCAGG - Intronic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
969310257 4:6348808-6348830 CTTCAGGTGCAGCTTGATCCAGG - Intronic
969630223 4:8331514-8331536 ATCCAGGCACGGATGGATCCAGG - Intergenic
970916718 4:21344370-21344392 CTACATCCACAGATGGCTCCAGG - Intronic
971370113 4:26012153-26012175 CTTCAGGCACAGCTCAATCCAGG - Intergenic
971371313 4:26021567-26021589 CTTCAGTCATGGCTGGATCCAGG + Intergenic
971699775 4:29956108-29956130 CTTCAGGTACAGCAGGATTCAGG + Intergenic
972329288 4:38049614-38049636 TTTCACACACAGATGGCTCCTGG - Exonic
973369625 4:49234988-49235010 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
973391406 4:49560428-49560450 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
975179297 4:71325451-71325473 CTTCAGGCATGGGTGGATCTAGG + Intronic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976832222 4:89328407-89328429 CTTCAGGCACAGGTTGATCCAGG + Intergenic
979240237 4:118441319-118441341 CTTCAGGCATGGCTTGATCCAGG + Intergenic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
982137686 4:152287592-152287614 CATCAGGCATGGCTGGATCCAGG - Intergenic
982265251 4:153532940-153532962 CTTCAGGCACAGGTGGATTTAGG + Intronic
982317175 4:154043725-154043747 CCCCAGTCACAGTTGGATCCAGG + Intergenic
985774732 5:1834943-1834965 CTCCGGGCAGAGATGGAGCCTGG + Intergenic
985948404 5:3204162-3204184 CTTCAGGCACAGCTGTACCCAGG - Intergenic
986736626 5:10673214-10673236 CTTCAGGCGCATATGGCTGCCGG + Intergenic
986757590 5:10852660-10852682 TTTCAGGTACAGCTTGATCCAGG - Intergenic
987191862 5:15486751-15486773 CTTCAAGCACAGATGCTTACTGG + Intergenic
987392740 5:17391197-17391219 CTTCAGGGATGGCTGGATCCAGG + Intergenic
987861978 5:23500557-23500579 CTTCAGGCTGAGATGTATCTGGG + Intergenic
990818319 5:59809872-59809894 CTCTAGGCAGAGATGGACCCCGG - Intronic
990939346 5:61186553-61186575 CTCCAAGCACAGATGGCTTCAGG - Intergenic
992358028 5:76005805-76005827 CTTCAGGTTCAGCTGGATCCAGG - Intergenic
992385895 5:76284528-76284550 TTTGAGGCACAGGTGGATCCAGG - Intronic
992419608 5:76589551-76589573 CTACAGACAGAGATGGATGCAGG - Intronic
993165351 5:84346909-84346931 CTTCAAACACAGGTGGATCCAGG - Intronic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
994739376 5:103599049-103599071 CTTCAAGAACAGCAGGATCCAGG - Intergenic
995133613 5:108657384-108657406 CTTCACTCATAGCTGGATCCAGG + Intergenic
995748963 5:115433984-115434006 CTTTAGGCAAGGCTGGATCCAGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
997516683 5:134495014-134495036 CTTCAGGCACAGTTTGATCCAGG - Intergenic
997702707 5:135915163-135915185 CTTCAGACATGGCTGGATCCAGG + Intergenic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
997846619 5:137292082-137292104 CTTCAGGCATGGCTGCATCCAGG - Intronic
998207657 5:140170345-140170367 TTTCAGGTATAGCTGGATCCAGG - Intergenic
998397806 5:141830492-141830514 CTTCAGGCATAGCTGAATCAAGG + Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
999154253 5:149447013-149447035 CTTCAGGCATGGCTGGTTCCAGG + Intergenic
999178305 5:149647773-149647795 CTTCAGGCATGGCTGAATCCAGG - Intergenic
999233140 5:150074183-150074205 CTTCAGGAACACTTGGATCCAGG - Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
999710937 5:154317816-154317838 CTTCAGTCATAGCTCGATCCGGG + Intronic
999917733 5:156281766-156281788 CTTCAGGCATGGTTAGATCCAGG + Intronic
1000278372 5:159760450-159760472 CTTCAGGCACAGATGGGTTCAGG - Intergenic
1000283225 5:159800735-159800757 CTTCAGGCATGACTGGATCCTGG + Intergenic
1000375335 5:160575858-160575880 CTTCAGGCAAAGCTGGATGCAGG + Intronic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001230874 5:169987047-169987069 CTTCAGGCATGGATGTATCTAGG + Intronic
1001300357 5:170529127-170529149 CTTCAGGCAGAGCTGAATACAGG + Intronic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001416729 5:171550227-171550249 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1001436599 5:171704155-171704177 TTTCAGGCATGGCTGGATCCAGG - Intergenic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001486632 5:172124252-172124274 CTTCAGGCACAGCTTGTTCCAGG - Intronic
1001492646 5:172166285-172166307 CTTCAGGTACAGCTGTCTCCAGG - Intronic
1001516108 5:172356297-172356319 CTTCAAGCAGAGCTGGATCTGGG - Intronic
1001524767 5:172420931-172420953 CTTCAGGCACATCTTAATCCAGG - Intronic
1001564981 5:172694210-172694232 CTTCAGGAACAGCTAGATCCGGG + Intergenic
1001585072 5:172828279-172828301 TTTCAGGCACAGTTGGATACAGG - Intergenic
1001648661 5:173300072-173300094 TTTCAGGCATAGCTGGACCCAGG - Intergenic
1001669207 5:173460067-173460089 ATTCAGGCATAGCTGGATCCAGG + Intergenic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1001966877 5:175916102-175916124 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1002051102 5:176571869-176571891 CTTCAGGCATGGCTAGATCCAGG + Intronic
1002051108 5:176571958-176571980 CTTCAGGCATGGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002081041 5:176737650-176737672 CTTCAGGTACGGCTGAATCCAGG + Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002087027 5:176782412-176782434 CATGAGGCACAGCTGGATTCAGG + Intergenic
1002087308 5:176784296-176784318 CTTCAGGCATGGCAGGATCCAGG + Intergenic
1002093854 5:176819438-176819460 CTTCAGGCATGGTTGTATCCAGG + Intronic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002130303 5:177077426-177077448 CTTCAGGCAAGGCTTGATCCGGG + Intronic
1002250069 5:177923104-177923126 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1002534982 5:179871137-179871159 CTTCAGGCATGGCTGGATCCAGG - Intronic
1002633789 5:180597183-180597205 CTTCAGGGAAAGGTTGATCCAGG + Intergenic
1002740489 5:181431902-181431924 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1003977142 6:11354965-11354987 CTTCAGGCACAAGTGGATACAGG - Intronic
1004317779 6:14605516-14605538 CTTCAGACATGGCTGGATCCAGG - Intergenic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1004649099 6:17591386-17591408 TTTCAGGCATAGTTGGATCCAGG + Intergenic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1007219464 6:40267018-40267040 CTTCAGGCATGGTTTGATCCAGG - Intergenic
1008474932 6:51926329-51926351 CTTGAGGCACAGCTGAGTCCAGG - Intronic
1009518043 6:64644224-64644246 TTTCAAGCACAGCTGGATCCAGG - Intronic
1009537793 6:64911929-64911951 CTTCAGATACGGCTGGATCCAGG + Intronic
1009607412 6:65891116-65891138 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1012652390 6:101772048-101772070 CTTCAAACATAGCTGGATCCAGG + Intronic
1012937655 6:105384896-105384918 CTTTAGGCACAGTCTGATCCAGG - Intronic
1013870965 6:114759133-114759155 CTTCAGGCACACATGGCTCTTGG + Intergenic
1016407106 6:143742242-143742264 CTTCAGGCGTGGTTGGATCCAGG + Intronic
1016645510 6:146402951-146402973 CTTCAGGCATACTTGTATCCTGG + Intronic
1018262463 6:161984211-161984233 CATCAGGCATAGCTGGATCCAGG - Intronic
1018441309 6:163815994-163816016 CTTCAAGCACTGATGGCTGCTGG - Intergenic
1018816424 6:167336033-167336055 ATTCAGGGAGAGATGGATACAGG - Intronic
1018862528 6:167721385-167721407 CTTCAGGCGCGGATGAATCCAGG - Intergenic
1018928561 6:168223933-168223955 CTTCAGGCATGGTTGGATCTAGG + Intergenic
1019245599 6:170707503-170707525 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1019324874 7:433111-433133 CTTCAGGCACGGCTGGATTCAGG - Intergenic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019495747 7:1339789-1339811 CTTCAGGCATGGCTTGATCCAGG - Intergenic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020087647 7:5320163-5320185 CTTCAGGCATGATTGGATCCAGG - Intronic
1020119777 7:5496465-5496487 CTTTAGCCACCTATGGATCCAGG - Intronic
1020254389 7:6494550-6494572 CTTCAGGTATGGCTGGATCCAGG + Intergenic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1020432869 7:8131239-8131261 CTTCAAGCAAGGCTGGATCCAGG - Intronic
1021840608 7:24718835-24718857 CTCCAGTCACTGCTGGATCCAGG - Intronic
1021866431 7:24962743-24962765 CTTCAGGCACGGCTGGACCTAGG - Intronic
1022630105 7:32076758-32076780 CTTCAGGCATAGCAGGATCAGGG - Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024097011 7:45990159-45990181 CTTCAGGAACAGCTCCATCCAGG - Intergenic
1024606883 7:51028821-51028843 CTTCAGGCACAGACGAAGACAGG + Exonic
1025206668 7:56997002-56997024 CTTCAGGCATGGTTGGATCCAGG + Intergenic
1025213229 7:57033276-57033298 CTTCAGGCACGGCTGCATCCAGG + Intergenic
1025256492 7:57387096-57387118 CTTCAGGCATATCTAGATCCAGG - Intergenic
1025658724 7:63543548-63543570 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1025665272 7:63579925-63579947 CTTCAGGCATGGTTGGATCCAGG - Intergenic
1026937063 7:74263602-74263624 ATTCAGGCAGAGATGGAGACAGG - Intergenic
1026945516 7:74313595-74313617 CTTCAGGCTCAGCTGGATCTAGG + Intronic
1027514659 7:79126564-79126586 CTTCAGGCATATCTAGATCCAGG - Intronic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1028536144 7:91890050-91890072 CCTCAGGCACAACTGAATCCAGG + Intergenic
1029148223 7:98461958-98461980 CTTTAGGCATAGCTGTATCCAGG - Intergenic
1029433302 7:100546465-100546487 AGTCAGGCACTGATGGATCAGGG - Intronic
1029683444 7:102128526-102128548 CTTCAGGCAGGGCTGCATCCAGG + Intronic
1030360420 7:108589764-108589786 TTTCAGGCACAGCTGGACCTAGG - Intergenic
1031163741 7:118201406-118201428 CTTTAGGCATCGCTGGATCCAGG - Intergenic
1031605885 7:123767392-123767414 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1034219574 7:149433312-149433334 CATCAGGCATGGCTGGATCCAGG - Intronic
1035523646 8:294759-294781 CATCAGGCATGGCTGGATCCAGG - Intergenic
1035664209 8:1368833-1368855 CATCAGGAATAGATGGTTCCAGG - Intergenic
1036793618 8:11740097-11740119 CTTCAGGCTCAGATACAACCAGG - Intronic
1037191177 8:16127737-16127759 CTTCAGGCATAGCAGGATCCAGG - Intronic
1037399211 8:18476731-18476753 CTTCACACACAGGTGGAACCAGG - Intergenic
1037714843 8:21388546-21388568 TTTCAGGAAAAGATGCATCCTGG - Intergenic
1037936442 8:22917970-22917992 CTTCAGGCGAGGCTGGATCCAGG - Intronic
1038258108 8:25969705-25969727 GTTTGGGGACAGATGGATCCAGG + Intronic
1038781718 8:30573880-30573902 CTTCAGACTCAGCTGGACCCAGG + Intergenic
1041390260 8:57341486-57341508 CCTCAGGCACAGAGATATCCTGG - Intergenic
1041612545 8:59868920-59868942 CTTCAGCCAAAGAAGGATGCGGG + Intergenic
1042099679 8:65261538-65261560 CTTCAGGCATAGCTGAATACAGG + Intergenic
1042385474 8:68169054-68169076 CTTCAGGCACAGCTCTATCCAGG + Intronic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044404658 8:91814305-91814327 CTTCATGCACTTATGGGTCCAGG + Intergenic
1044716166 8:95101855-95101877 CTTCTGACCCAGCTGGATCCAGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1046646005 8:116786314-116786336 CTTCAGTCTCAGCTGGATCTAGG + Intronic
1046660754 8:116946189-116946211 TTCCAGGCACAGAGGGATTCTGG - Intergenic
1046716514 8:117573757-117573779 CTTCAGGCACAGCTGTAACCAGG - Intergenic
1046974430 8:120258165-120258187 CTTCAGGCACATCTGGACCTAGG + Intronic
1047007019 8:120630998-120631020 CTTCAGGCATGGTGGGATCCAGG - Intronic
1047495107 8:125403650-125403672 GTTCAGCCACAGCTGGATGCAGG - Intergenic
1047709793 8:127540151-127540173 CTTCAGTCTCAACTGGATCCAGG - Intergenic
1047716522 8:127600604-127600626 TTTCAGGGACAGATGGATCCAGG + Intergenic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1047930271 8:129721638-129721660 CTTCAGACAGGGCTGGATCCAGG + Intergenic
1047974825 8:130119647-130119669 ATTCAGGTACAGCTGGATCCAGG - Intronic
1048066848 8:130978967-130978989 CTTCAGGCACAGCTTGGTCCAGG - Intronic
1048131462 8:131702292-131702314 CTTCAGGCGTGGCTGGATCCAGG - Intergenic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1048497131 8:134944644-134944666 ATTCAAGCATAAATGGATCCAGG - Intergenic
1048503111 8:134996686-134996708 CTTTAGGCAAAGCTGGATTCCGG + Intergenic
1049572755 8:143377397-143377419 CTTCAGGCCCAGGGGGATCATGG - Exonic
1050365137 9:4867170-4867192 CTTCAGGTAAAGCTGGATCTAGG + Intronic
1051437348 9:17047231-17047253 TTTCAGGCATAGCTGGATCCAGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052273958 9:26657353-26657375 CTTCAGGCACCACTGGATCCAGG + Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052606363 9:30707704-30707726 CTTAAGGCACAGATTGCTCATGG + Intergenic
1053652243 9:40180970-40180992 CTTCAGGTACAGCTAGATTCAGG + Intergenic
1053902638 9:42810283-42810305 CTTCAGGTACAGCTAGATTCAGG + Intergenic
1054532339 9:66195235-66195257 CTTCAGGTACAGCTAGATTCAGG - Intergenic
1054883715 9:70173027-70173049 CTTCAGGCACAGCTTGATGCAGG + Intronic
1055122521 9:72678295-72678317 CCTCAGGCACAGATAAATCTTGG + Intronic
1055649175 9:78390292-78390314 CATCAGGTATAGCTGGATCCAGG - Intergenic
1055754414 9:79542638-79542660 CTTCAGGCAAGGTTTGATCCAGG - Intergenic
1055788083 9:79892601-79892623 CTTCAGGCAAGGCTGGATCGGGG - Intergenic
1055920282 9:81452890-81452912 TCTCAGGCACAGTTAGATCCAGG - Intergenic
1056774768 9:89503210-89503232 CTCCAGGTACAGTTAGATCCAGG + Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057820971 9:98330429-98330451 CTTCAGGCACAGTTTGATCAGGG - Intronic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1058533365 9:105929395-105929417 CTTCAGGCATAGTTGAATCCAGG + Intergenic
1058670732 9:107358702-107358724 CTTCAGGCACAGCTAGATTCAGG - Intergenic
1058886573 9:109326112-109326134 CTTCAGGCATGGCTGAATCCAGG - Intergenic
1058998503 9:110323700-110323722 CTTCAGGCATGGATAGATTCAGG + Intronic
1059668039 9:116467595-116467617 CTTCAGCCCCAGCTGAATCCAGG - Intronic
1059976309 9:119721588-119721610 CTTCAGGAACAACTGCATCCAGG + Intergenic
1060108329 9:120888790-120888812 CTGCAGGCACAGTCTGATCCAGG + Intronic
1060485649 9:124044910-124044932 CTCCAGGCAAAGATGGATGTGGG + Intergenic
1060887739 9:127167428-127167450 CTTCAGGGTCAGATGGACTCCGG + Intronic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1061362092 9:130150058-130150080 CTTCAGGCAAGGCTTGATCCAGG - Intergenic
1061417097 9:130453032-130453054 CTTCAGGCAGGGCTGGATCCAGG + Intronic
1061713113 9:132501164-132501186 CTTCAGGCATAGCAGGATCTAGG + Intronic
1061744936 9:132732733-132732755 CTACAGGCACAGCTTGAACCAGG - Intronic
1062350732 9:136137481-136137503 GTTCTGGCACAGATGGCTCTAGG + Intergenic
1062521189 9:136958690-136958712 CTTCAGGCCTGGCTGGATCCAGG + Intergenic
1203605798 Un_KI270748v1:56710-56732 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1185627425 X:1492583-1492605 CTTCAGGCATGGCTGGATCCAGG - Intronic
1186615601 X:11184089-11184111 ATTTAGGCACGGCTGGATCCAGG - Intronic
1187336750 X:18388244-18388266 CTTCAGGCATGGAGGGATCCAGG - Intergenic
1187561471 X:20407412-20407434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1188413294 X:29900856-29900878 CTAGAGGCACTGATGGATACAGG + Intronic
1189308019 X:40001922-40001944 CTTCAGGTTCAACTGGATCCAGG + Intergenic
1192129983 X:68540724-68540746 CTTCAGGCACAGCTGGACTCAGG - Intergenic
1194665206 X:96670421-96670443 GTCAAGGCACAGAGGGATCCAGG - Intergenic
1194769063 X:97878073-97878095 CTTTAGACACAGATGCATTCAGG - Intergenic
1196668474 X:118341560-118341582 CTTCAGGTATGGCTGGATCCAGG - Intergenic
1196885684 X:120243336-120243358 CTTAAGGCACAGATAAAACCAGG - Intergenic
1197057201 X:122135359-122135381 CTTCAGCCTCTGATTGATCCTGG - Intergenic
1199270969 X:145882235-145882257 CTTCAGGCAGTGCTGGACCCAGG + Intergenic
1200793682 Y:7321445-7321467 CTTGAGGCATAAAGGGATCCAGG - Intergenic
1201188145 Y:11423429-11423451 TTTCAGGCATAGCTGGATACAGG - Intergenic
1201400812 Y:13602118-13602140 CTTCAGCCTCTGATGGGTCCTGG + Intergenic
1202387972 Y:24343148-24343170 CTTCAGGCATGGCTTGATCCAGG + Intergenic
1202482815 Y:25326980-25327002 CTTCAGGCATGGCTTGATCCAGG - Intergenic