ID: 903663189

View in Genome Browser
Species Human (GRCh38)
Location 1:24991188-24991210
Sequence CATTGTTACCTCACCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663189_903663192 -3 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data
903663189_903663201 30 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663201 1:24991241-24991263 CCCTTTTCCAGCTTGGGCTCTGG No data
903663189_903663198 23 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663198 1:24991234-24991256 CTGACTTCCCTTTTCCAGCTTGG No data
903663189_903663193 -2 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data
903663189_903663199 24 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663189 Original CRISPR CATTGTTACCTCACCCAGCA GGG (reversed) Intergenic
No off target data available for this crispr