ID: 903663192

View in Genome Browser
Species Human (GRCh38)
Location 1:24991208-24991230
Sequence ATGTCCTGCCCCAGGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663187_903663192 9 Left 903663187 1:24991176-24991198 CCATGGAAGTCACCCTGCTGGGT No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data
903663184_903663192 14 Left 903663184 1:24991171-24991193 CCAGTCCATGGAAGTCACCCTGC No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data
903663189_903663192 -3 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data
903663190_903663192 -4 Left 903663190 1:24991189-24991211 CCTGCTGGGTGAGGTAACAATGT No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data
903663182_903663192 29 Left 903663182 1:24991156-24991178 CCTCTCTCTCTTCTGCCAGTCCA No data
Right 903663192 1:24991208-24991230 ATGTCCTGCCCCAGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663192 Original CRISPR ATGTCCTGCCCCAGGCATTC AGG Intergenic
No off target data available for this crispr