ID: 903663193

View in Genome Browser
Species Human (GRCh38)
Location 1:24991209-24991231
Sequence TGTCCTGCCCCAGGCATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663184_903663193 15 Left 903663184 1:24991171-24991193 CCAGTCCATGGAAGTCACCCTGC No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data
903663190_903663193 -3 Left 903663190 1:24991189-24991211 CCTGCTGGGTGAGGTAACAATGT No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data
903663182_903663193 30 Left 903663182 1:24991156-24991178 CCTCTCTCTCTTCTGCCAGTCCA No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data
903663189_903663193 -2 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data
903663187_903663193 10 Left 903663187 1:24991176-24991198 CCATGGAAGTCACCCTGCTGGGT No data
Right 903663193 1:24991209-24991231 TGTCCTGCCCCAGGCATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663193 Original CRISPR TGTCCTGCCCCAGGCATTCA GGG Intergenic
No off target data available for this crispr