ID: 903663199

View in Genome Browser
Species Human (GRCh38)
Location 1:24991235-24991257
Sequence TGACTTCCCTTTTCCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663194_903663199 0 Left 903663194 1:24991212-24991234 CCTGCCCCAGGCATTCAGGGATC No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data
903663190_903663199 23 Left 903663190 1:24991189-24991211 CCTGCTGGGTGAGGTAACAATGT No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data
903663195_903663199 -4 Left 903663195 1:24991216-24991238 CCCCAGGCATTCAGGGATCTGAC No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data
903663189_903663199 24 Left 903663189 1:24991188-24991210 CCCTGCTGGGTGAGGTAACAATG No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data
903663196_903663199 -5 Left 903663196 1:24991217-24991239 CCCAGGCATTCAGGGATCTGACT No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data
903663197_903663199 -6 Left 903663197 1:24991218-24991240 CCAGGCATTCAGGGATCTGACTT No data
Right 903663199 1:24991235-24991257 TGACTTCCCTTTTCCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663199 Original CRISPR TGACTTCCCTTTTCCAGCTT GGG Intergenic
No off target data available for this crispr