ID: 903663498

View in Genome Browser
Species Human (GRCh38)
Location 1:24993090-24993112
Sequence AGTTTTCCAGACGTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663490_903663498 1 Left 903663490 1:24993066-24993088 CCACTCCTGCCCTCCCTGGGGAT No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663492_903663498 -8 Left 903663492 1:24993075-24993097 CCCTCCCTGGGGATGAGTTTTCC No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663493_903663498 -9 Left 903663493 1:24993076-24993098 CCTCCCTGGGGATGAGTTTTCCA No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663485_903663498 7 Left 903663485 1:24993060-24993082 CCCAGGCCACTCCTGCCCTCCCT No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663486_903663498 6 Left 903663486 1:24993061-24993083 CCAGGCCACTCCTGCCCTCCCTG No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663491_903663498 -4 Left 903663491 1:24993071-24993093 CCTGCCCTCCCTGGGGATGAGTT No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663484_903663498 15 Left 903663484 1:24993052-24993074 CCGGGATGCCCAGGCCACTCCTG No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663483_903663498 18 Left 903663483 1:24993049-24993071 CCTCCGGGATGCCCAGGCCACTC No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data
903663482_903663498 19 Left 903663482 1:24993048-24993070 CCCTCCGGGATGCCCAGGCCACT No data
Right 903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663498 Original CRISPR AGTTTTCCAGACGTGTGCTG GGG Intergenic
No off target data available for this crispr