ID: 903663584

View in Genome Browser
Species Human (GRCh38)
Location 1:24993534-24993556
Sequence ACTTCCAATCATTAGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903663578_903663584 24 Left 903663578 1:24993487-24993509 CCCATTATATGGCAAAACCGTGA No data
Right 903663584 1:24993534-24993556 ACTTCCAATCATTAGCTGTGGGG No data
903663580_903663584 7 Left 903663580 1:24993504-24993526 CCGTGATGAATTGAATTTCTCTT No data
Right 903663584 1:24993534-24993556 ACTTCCAATCATTAGCTGTGGGG No data
903663579_903663584 23 Left 903663579 1:24993488-24993510 CCATTATATGGCAAAACCGTGAT No data
Right 903663584 1:24993534-24993556 ACTTCCAATCATTAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903663584 Original CRISPR ACTTCCAATCATTAGCTGTG GGG Intergenic
No off target data available for this crispr