ID: 903668261

View in Genome Browser
Species Human (GRCh38)
Location 1:25021160-25021182
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668261_903668273 7 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668261_903668270 -8 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668261_903668284 28 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668261_903668274 8 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668261_903668277 16 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668261_903668281 24 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668261_903668283 25 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668261_903668276 15 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668261_903668285 29 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668261 Original CRISPR CTGTAGGTCCTGGGGTGAGG GGG (reversed) Intergenic
No off target data available for this crispr