ID: 903668262

View in Genome Browser
Species Human (GRCh38)
Location 1:25021161-25021183
Sequence GCTGTAGGTCCTGGGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668262_903668276 14 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668262_903668284 27 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668262_903668274 7 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668262_903668273 6 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668262_903668283 24 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668262_903668270 -9 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668262_903668285 28 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668262_903668277 15 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668262_903668281 23 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668262 Original CRISPR GCTGTAGGTCCTGGGGTGAG GGG (reversed) Intergenic