ID: 903668266

View in Genome Browser
Species Human (GRCh38)
Location 1:25021168-25021190
Sequence TCCGTAGGCTGTAGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668266_903668276 7 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668266_903668281 16 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668266_903668283 17 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668266_903668274 0 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668266_903668285 21 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668266_903668287 30 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668266_903668277 8 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668266_903668273 -1 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668266_903668284 20 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668266 Original CRISPR TCCGTAGGCTGTAGGTCCTG GGG (reversed) Intergenic
No off target data available for this crispr