ID: 903668267

View in Genome Browser
Species Human (GRCh38)
Location 1:25021169-25021191
Sequence CTCCGTAGGCTGTAGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668267_903668288 30 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG No data
903668267_903668277 7 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668267_903668274 -1 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668267_903668276 6 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668267_903668284 19 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668267_903668285 20 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668267_903668273 -2 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668267_903668283 16 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668267_903668281 15 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668267_903668287 29 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668267 Original CRISPR CTCCGTAGGCTGTAGGTCCT GGG (reversed) Intergenic