ID: 903668268

View in Genome Browser
Species Human (GRCh38)
Location 1:25021170-25021192
Sequence CCTCCGTAGGCTGTAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668268_903668273 -3 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668268_903668290 30 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668290 1:25021223-25021245 CCTCAGGGAGGGTGCAGACGGGG No data
903668268_903668281 14 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668268_903668284 18 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668268_903668285 19 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668268_903668274 -2 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668268_903668288 29 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG No data
903668268_903668276 5 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668268_903668283 15 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668268_903668287 28 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668268_903668277 6 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668268 Original CRISPR CCTCCGTAGGCTGTAGGTCC TGG (reversed) Intergenic