ID: 903668270

View in Genome Browser
Species Human (GRCh38)
Location 1:25021175-25021197
Sequence ACCTACAGCCTACGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668262_903668270 -9 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668261_903668270 -8 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668259_903668270 21 Left 903668259 1:25021131-25021153 CCTCATACTCTCTGGACAGACAA No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668263_903668270 -10 Left 903668263 1:25021162-25021184 CCCTCACCCCAGGACCTACAGCC No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668258_903668270 25 Left 903668258 1:25021127-25021149 CCAGCCTCATACTCTCTGGACAG No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data
903668257_903668270 26 Left 903668257 1:25021126-25021148 CCCAGCCTCATACTCTCTGGACA No data
Right 903668270 1:25021175-25021197 ACCTACAGCCTACGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668270 Original CRISPR ACCTACAGCCTACGGAGGCC TGG Intergenic
No off target data available for this crispr