ID: 903668271

View in Genome Browser
Species Human (GRCh38)
Location 1:25021176-25021198
Sequence TCCAGGCCTCCGTAGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668271_903668285 13 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668271_903668277 0 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668271_903668276 -1 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668271_903668274 -8 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668274 1:25021191-25021213 GGCCTGGAGCCACCCAGCCTGGG No data
903668271_903668281 8 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668271_903668284 12 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668271_903668273 -9 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668273 1:25021190-25021212 AGGCCTGGAGCCACCCAGCCTGG No data
903668271_903668292 29 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668271_903668288 23 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG No data
903668271_903668291 25 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668271_903668283 9 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668271_903668287 22 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668271_903668290 24 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668290 1:25021223-25021245 CCTCAGGGAGGGTGCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668271 Original CRISPR TCCAGGCCTCCGTAGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr