ID: 903668272

View in Genome Browser
Species Human (GRCh38)
Location 1:25021183-25021205
Sequence GGGTGGCTCCAGGCCTCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668272_903668284 5 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668272_903668290 17 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668290 1:25021223-25021245 CCTCAGGGAGGGTGCAGACGGGG No data
903668272_903668283 2 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668272_903668293 25 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668293 1:25021231-25021253 AGGGTGCAGACGGGGGACGGAGG No data
903668272_903668281 1 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668272_903668276 -8 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668276 1:25021198-25021220 AGCCACCCAGCCTGGGCCGCAGG No data
903668272_903668294 26 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668294 1:25021232-25021254 GGGTGCAGACGGGGGACGGAGGG No data
903668272_903668288 16 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG No data
903668272_903668292 22 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668272_903668287 15 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668272_903668285 6 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668272_903668291 18 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668272_903668277 -7 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668272 Original CRISPR GGGTGGCTCCAGGCCTCCGT AGG (reversed) Intergenic
No off target data available for this crispr