ID: 903668275

View in Genome Browser
Species Human (GRCh38)
Location 1:25021193-25021215
Sequence GGCCCAGGCTGGGTGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668275_903668296 27 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668296 1:25021243-25021265 GGGGACGGAGGGCACAGGCCAGG No data
903668275_903668291 8 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668275_903668283 -8 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668283 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
903668275_903668285 -4 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG No data
903668275_903668284 -5 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668275_903668293 15 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668293 1:25021231-25021253 AGGGTGCAGACGGGGGACGGAGG No data
903668275_903668290 7 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668290 1:25021223-25021245 CCTCAGGGAGGGTGCAGACGGGG No data
903668275_903668287 5 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668275_903668295 22 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668295 1:25021238-25021260 AGACGGGGGACGGAGGGCACAGG No data
903668275_903668297 28 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668297 1:25021244-25021266 GGGACGGAGGGCACAGGCCAGGG No data
903668275_903668294 16 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668294 1:25021232-25021254 GGGTGCAGACGGGGGACGGAGGG No data
903668275_903668292 12 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668275_903668281 -9 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668281 1:25021207-25021229 GCCTGGGCCGCAGGGACCTCAGG No data
903668275_903668288 6 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668275 Original CRISPR GGCCCAGGCTGGGTGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr