ID: 903668277

View in Genome Browser
Species Human (GRCh38)
Location 1:25021199-25021221
Sequence GCCACCCAGCCTGGGCCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668271_903668277 0 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668266_903668277 8 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668262_903668277 15 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668268_903668277 6 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668263_903668277 14 Left 903668263 1:25021162-25021184 CCCTCACCCCAGGACCTACAGCC No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668264_903668277 13 Left 903668264 1:25021163-25021185 CCTCACCCCAGGACCTACAGCCT No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668261_903668277 16 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668272_903668277 -7 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data
903668267_903668277 7 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668277 1:25021199-25021221 GCCACCCAGCCTGGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668277 Original CRISPR GCCACCCAGCCTGGGCCGCA GGG Intergenic
No off target data available for this crispr