ID: 903668284

View in Genome Browser
Species Human (GRCh38)
Location 1:25021211-25021233
Sequence GGGCCGCAGGGACCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668266_903668284 20 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668263_903668284 26 Left 903668263 1:25021162-25021184 CCCTCACCCCAGGACCTACAGCC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668268_903668284 18 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668272_903668284 5 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668275_903668284 -5 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668264_903668284 25 Left 903668264 1:25021163-25021185 CCTCACCCCAGGACCTACAGCCT No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668271_903668284 12 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668267_903668284 19 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668261_903668284 28 Left 903668261 1:25021160-25021182 CCCCCTCACCCCAGGACCTACAG No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data
903668262_903668284 27 Left 903668262 1:25021161-25021183 CCCCTCACCCCAGGACCTACAGC No data
Right 903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668284 Original CRISPR GGGCCGCAGGGACCTCAGGG AGG Intergenic
No off target data available for this crispr