ID: 903668287

View in Genome Browser
Species Human (GRCh38)
Location 1:25021221-25021243
Sequence GACCTCAGGGAGGGTGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668282_903668287 -10 Left 903668282 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668275_903668287 5 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668271_903668287 22 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668272_903668287 15 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668267_903668287 29 Left 903668267 1:25021169-25021191 CCCAGGACCTACAGCCTACGGAG No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668268_903668287 28 Left 903668268 1:25021170-25021192 CCAGGACCTACAGCCTACGGAGG No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668278_903668287 -2 Left 903668278 1:25021200-25021222 CCACCCAGCCTGGGCCGCAGGGA No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668280_903668287 -6 Left 903668280 1:25021204-25021226 CCAGCCTGGGCCGCAGGGACCTC No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668279_903668287 -5 Left 903668279 1:25021203-25021225 CCCAGCCTGGGCCGCAGGGACCT No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data
903668266_903668287 30 Left 903668266 1:25021168-25021190 CCCCAGGACCTACAGCCTACGGA No data
Right 903668287 1:25021221-25021243 GACCTCAGGGAGGGTGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668287 Original CRISPR GACCTCAGGGAGGGTGCAGA CGG Intergenic
No off target data available for this crispr