ID: 903668291

View in Genome Browser
Species Human (GRCh38)
Location 1:25021224-25021246
Sequence CTCAGGGAGGGTGCAGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668282_903668291 -7 Left 903668282 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668278_903668291 1 Left 903668278 1:25021200-25021222 CCACCCAGCCTGGGCCGCAGGGA No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668279_903668291 -2 Left 903668279 1:25021203-25021225 CCCAGCCTGGGCCGCAGGGACCT No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668271_903668291 25 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668275_903668291 8 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668272_903668291 18 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data
903668280_903668291 -3 Left 903668280 1:25021204-25021226 CCAGCCTGGGCCGCAGGGACCTC No data
Right 903668291 1:25021224-25021246 CTCAGGGAGGGTGCAGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668291 Original CRISPR CTCAGGGAGGGTGCAGACGG GGG Intergenic
No off target data available for this crispr