ID: 903668292

View in Genome Browser
Species Human (GRCh38)
Location 1:25021228-25021250
Sequence GGGAGGGTGCAGACGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668272_903668292 22 Left 903668272 1:25021183-25021205 CCTACGGAGGCCTGGAGCCACCC No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668286_903668292 -9 Left 903668286 1:25021214-25021236 CCGCAGGGACCTCAGGGAGGGTG No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668271_903668292 29 Left 903668271 1:25021176-25021198 CCTACAGCCTACGGAGGCCTGGA No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668275_903668292 12 Left 903668275 1:25021193-25021215 CCTGGAGCCACCCAGCCTGGGCC No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668282_903668292 -3 Left 903668282 1:25021208-25021230 CCTGGGCCGCAGGGACCTCAGGG No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668279_903668292 2 Left 903668279 1:25021203-25021225 CCCAGCCTGGGCCGCAGGGACCT No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668280_903668292 1 Left 903668280 1:25021204-25021226 CCAGCCTGGGCCGCAGGGACCTC No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data
903668278_903668292 5 Left 903668278 1:25021200-25021222 CCACCCAGCCTGGGCCGCAGGGA No data
Right 903668292 1:25021228-25021250 GGGAGGGTGCAGACGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668292 Original CRISPR GGGAGGGTGCAGACGGGGGA CGG Intergenic
No off target data available for this crispr