ID: 903668657

View in Genome Browser
Species Human (GRCh38)
Location 1:25022746-25022768
Sequence CAGAGGCCCAGAGCCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903668657_903668665 2 Left 903668657 1:25022746-25022768 CCACCGTGGGCTCTGGGCCTCTG No data
Right 903668665 1:25022771-25022793 GGGCTCCCCTGGCACCCATGGGG No data
903668657_903668664 1 Left 903668657 1:25022746-25022768 CCACCGTGGGCTCTGGGCCTCTG No data
Right 903668664 1:25022770-25022792 TGGGCTCCCCTGGCACCCATGGG No data
903668657_903668661 -9 Left 903668657 1:25022746-25022768 CCACCGTGGGCTCTGGGCCTCTG No data
Right 903668661 1:25022760-25022782 GGGCCTCTGCTGGGCTCCCCTGG No data
903668657_903668663 0 Left 903668657 1:25022746-25022768 CCACCGTGGGCTCTGGGCCTCTG No data
Right 903668663 1:25022769-25022791 CTGGGCTCCCCTGGCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903668657 Original CRISPR CAGAGGCCCAGAGCCCACGG TGG (reversed) Intergenic
No off target data available for this crispr