ID: 903669678

View in Genome Browser
Species Human (GRCh38)
Location 1:25028091-25028113
Sequence CCCATGGATGTGCCTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903669666_903669678 22 Left 903669666 1:25028046-25028068 CCGCCTCCAGCTGGGAGCCTCCT No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669669_903669678 5 Left 903669669 1:25028063-25028085 CCTCCTCTGCACTCTCTGTCCTC No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669668_903669678 16 Left 903669668 1:25028052-25028074 CCAGCTGGGAGCCTCCTCTGCAC No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669665_903669678 25 Left 903669665 1:25028043-25028065 CCACCGCCTCCAGCTGGGAGCCT No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669664_903669678 26 Left 903669664 1:25028042-25028064 CCCACCGCCTCCAGCTGGGAGCC No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669667_903669678 19 Left 903669667 1:25028049-25028071 CCTCCAGCTGGGAGCCTCCTCTG No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data
903669670_903669678 2 Left 903669670 1:25028066-25028088 CCTCTGCACTCTCTGTCCTCCAA No data
Right 903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903669678 Original CRISPR CCCATGGATGTGCCTCCAGG GGG Intergenic
No off target data available for this crispr