ID: 903670777

View in Genome Browser
Species Human (GRCh38)
Location 1:25034210-25034232
Sequence GGGCCTGGCTCGGCAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670777_903670784 -5 Left 903670777 1:25034210-25034232 CCACCCCCTGCCGAGCCAGGCCC No data
Right 903670784 1:25034228-25034250 GGCCCTCCTGCACTCACACTTGG No data
903670777_903670791 28 Left 903670777 1:25034210-25034232 CCACCCCCTGCCGAGCCAGGCCC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670777_903670785 -4 Left 903670777 1:25034210-25034232 CCACCCCCTGCCGAGCCAGGCCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670777 Original CRISPR GGGCCTGGCTCGGCAGGGGG TGG (reversed) Intergenic
No off target data available for this crispr