ID: 903670778

View in Genome Browser
Species Human (GRCh38)
Location 1:25034213-25034235
Sequence GGAGGGCCTGGCTCGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670778_903670791 25 Left 903670778 1:25034213-25034235 CCCCCTGCCGAGCCAGGCCCTCC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670778_903670785 -7 Left 903670778 1:25034213-25034235 CCCCCTGCCGAGCCAGGCCCTCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670778_903670784 -8 Left 903670778 1:25034213-25034235 CCCCCTGCCGAGCCAGGCCCTCC No data
Right 903670784 1:25034228-25034250 GGCCCTCCTGCACTCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670778 Original CRISPR GGAGGGCCTGGCTCGGCAGG GGG (reversed) Intergenic
No off target data available for this crispr