ID: 903670779

View in Genome Browser
Species Human (GRCh38)
Location 1:25034214-25034236
Sequence AGGAGGGCCTGGCTCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670779_903670785 -8 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670779_903670791 24 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670779_903670784 -9 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670784 1:25034228-25034250 GGCCCTCCTGCACTCACACTTGG No data
903670779_903670793 30 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670779 Original CRISPR AGGAGGGCCTGGCTCGGCAG GGG (reversed) Intergenic
No off target data available for this crispr