ID: 903670781

View in Genome Browser
Species Human (GRCh38)
Location 1:25034216-25034238
Sequence GCAGGAGGGCCTGGCTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670781_903670785 -10 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670781_903670791 22 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670781_903670793 28 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670781_903670794 29 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670781 Original CRISPR GCAGGAGGGCCTGGCTCGGC AGG (reversed) Intergenic
No off target data available for this crispr