ID: 903670783

View in Genome Browser
Species Human (GRCh38)
Location 1:25034225-25034247
Sequence AGTGTGAGTGCAGGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670783_903670791 13 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670783_903670793 19 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670783_903670794 20 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670783 Original CRISPR AGTGTGAGTGCAGGAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr