ID: 903670785

View in Genome Browser
Species Human (GRCh38)
Location 1:25034229-25034251
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670769_903670785 23 Left 903670769 1:25034183-25034205 CCCCAGCAGGAAGTGGCTGGCCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670776_903670785 -3 Left 903670776 1:25034209-25034231 CCCACCCCCTGCCGAGCCAGGCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670770_903670785 22 Left 903670770 1:25034184-25034206 CCCAGCAGGAAGTGGCTGGCCCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670778_903670785 -7 Left 903670778 1:25034213-25034235 CCCCCTGCCGAGCCAGGCCCTCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670779_903670785 -8 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670777_903670785 -4 Left 903670777 1:25034210-25034232 CCACCCCCTGCCGAGCCAGGCCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670774_903670785 1 Left 903670774 1:25034205-25034227 CCTTCCCACCCCCTGCCGAGCCA No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670773_903670785 2 Left 903670773 1:25034204-25034226 CCCTTCCCACCCCCTGCCGAGCC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670772_903670785 3 Left 903670772 1:25034203-25034225 CCCCTTCCCACCCCCTGCCGAGC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670767_903670785 27 Left 903670767 1:25034179-25034201 CCAGCCCCAGCAGGAAGTGGCTG No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670781_903670785 -10 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670780_903670785 -9 Left 903670780 1:25034215-25034237 CCCTGCCGAGCCAGGCCCTCCTG No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data
903670771_903670785 21 Left 903670771 1:25034185-25034207 CCAGCAGGAAGTGGCTGGCCCCT No data
Right 903670785 1:25034229-25034251 GCCCTCCTGCACTCACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr