ID: 903670791

View in Genome Browser
Species Human (GRCh38)
Location 1:25034261-25034283
Sequence GCCTGAAAGTCCCTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670781_903670791 22 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670776_903670791 29 Left 903670776 1:25034209-25034231 CCCACCCCCTGCCGAGCCAGGCC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670787_903670791 7 Left 903670787 1:25034231-25034253 CCTCCTGCACTCACACTTGGGAA No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670780_903670791 23 Left 903670780 1:25034215-25034237 CCCTGCCGAGCCAGGCCCTCCTG No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670779_903670791 24 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670783_903670791 13 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670782_903670791 18 Left 903670782 1:25034220-25034242 CCGAGCCAGGCCCTCCTGCACTC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670777_903670791 28 Left 903670777 1:25034210-25034232 CCACCCCCTGCCGAGCCAGGCCC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670788_903670791 4 Left 903670788 1:25034234-25034256 CCTGCACTCACACTTGGGAACCA No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670778_903670791 25 Left 903670778 1:25034213-25034235 CCCCCTGCCGAGCCAGGCCCTCC No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data
903670786_903670791 8 Left 903670786 1:25034230-25034252 CCCTCCTGCACTCACACTTGGGA No data
Right 903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670791 Original CRISPR GCCTGAAAGTCCCTGTTCTC AGG Intergenic
No off target data available for this crispr