ID: 903670793

View in Genome Browser
Species Human (GRCh38)
Location 1:25034267-25034289
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670789_903670793 -10 Left 903670789 1:25034254-25034276 CCAGCCAGCCTGAAAGTCCCTGT No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670780_903670793 29 Left 903670780 1:25034215-25034237 CCCTGCCGAGCCAGGCCCTCCTG No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670788_903670793 10 Left 903670788 1:25034234-25034256 CCTGCACTCACACTTGGGAACCA No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670786_903670793 14 Left 903670786 1:25034230-25034252 CCCTCCTGCACTCACACTTGGGA No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670781_903670793 28 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670787_903670793 13 Left 903670787 1:25034231-25034253 CCTCCTGCACTCACACTTGGGAA No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670783_903670793 19 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670779_903670793 30 Left 903670779 1:25034214-25034236 CCCCTGCCGAGCCAGGCCCTCCT No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data
903670782_903670793 24 Left 903670782 1:25034220-25034242 CCGAGCCAGGCCCTCCTGCACTC No data
Right 903670793 1:25034267-25034289 AAGTCCCTGTTCTCAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type