ID: 903670794

View in Genome Browser
Species Human (GRCh38)
Location 1:25034268-25034290
Sequence AGTCCCTGTTCTCAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903670781_903670794 29 Left 903670781 1:25034216-25034238 CCTGCCGAGCCAGGCCCTCCTGC No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670786_903670794 15 Left 903670786 1:25034230-25034252 CCCTCCTGCACTCACACTTGGGA No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670782_903670794 25 Left 903670782 1:25034220-25034242 CCGAGCCAGGCCCTCCTGCACTC No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670783_903670794 20 Left 903670783 1:25034225-25034247 CCAGGCCCTCCTGCACTCACACT No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670789_903670794 -9 Left 903670789 1:25034254-25034276 CCAGCCAGCCTGAAAGTCCCTGT No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670780_903670794 30 Left 903670780 1:25034215-25034237 CCCTGCCGAGCCAGGCCCTCCTG No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670787_903670794 14 Left 903670787 1:25034231-25034253 CCTCCTGCACTCACACTTGGGAA No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data
903670788_903670794 11 Left 903670788 1:25034234-25034256 CCTGCACTCACACTTGGGAACCA No data
Right 903670794 1:25034268-25034290 AGTCCCTGTTCTCAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903670794 Original CRISPR AGTCCCTGTTCTCAGGTTCT GGG Intergenic