ID: 903680244

View in Genome Browser
Species Human (GRCh38)
Location 1:25091698-25091720
Sequence GCCCCCAACCCCTTAACCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903680241_903680244 30 Left 903680241 1:25091645-25091667 CCAGAGGAGTTAAATGATTTGCC No data
Right 903680244 1:25091698-25091720 GCCCCCAACCCCTTAACCTACGG No data
903680242_903680244 9 Left 903680242 1:25091666-25091688 CCAAATATTGTGCAGACACAGAC No data
Right 903680244 1:25091698-25091720 GCCCCCAACCCCTTAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903680244 Original CRISPR GCCCCCAACCCCTTAACCTA CGG Intergenic
No off target data available for this crispr